DNASU Plasmid Repository • 480.965.5697 | Email

Pathways Results

TOP

Pathway : O-glycosylation of TSR domain-containing proteins, 50 clones found

No of Result Per Page : Page: Explanation of Terms
  DNASU
Plasmid ID
Clone
Type
Gene
Symbol
Gene
Name
Keywords Reference
Sequence
Mutation/
Discrepancy
Insert
Format
Vector Selection
Markers
 
1 HsCD00021817 Plasmid Details cDNA ADAMTS1 ADAM metallopeptidase with thrombospondin type 1 motif, 1 NA BC036515 No/No CLOSED pDNR-Dual bacterial:ampicillin
2 HsCD00042451 Plasmid Details cDNA ADAMTS1 ADAM metallopeptidase with thrombospondin type 1 motif, 1 NA BC036515 No/No FUSION pDONR221 bacterial:kanamycin
3 HsCD00076529 Plasmid Details cDNA ADAMTS1 a disintegrin-like and metalloprotease (reprolysin type) with thrombospondin type 1 motif, 1 NA BC036515 No/No CLOSED pDONR221 bacterial:kanamycin
4 HsCD00081210 Plasmid Details cDNA ADAMTS14 a disintegrin-like and metalloprotease (reprolysin type) with thrombospondin type 1 motif, 14 NA NM_139155 No/No FUSION pENTR223.1 bacterial:spectinomycin
5 HsCD00081236 Plasmid Details cDNA ADAMTS16 a disintegrin-like and metalloprotease (reprolysin type) with thrombospondin type 1 motif, 16 NA NM_139056 No/No FUSION pENTR223.1 bacterial:spectinomycin
6 HsCD00295138 Plasmid Details cDNA ADAMTSL4 ADAMTS-like 4 NA NM_019032.4 No/No CLOSED pENTR223.1 bacterial:spectinomycin
7 HsCD00297043 Plasmid Details cDNA ADAMTS17 ADAM metallopeptidase with thrombospondin type 1 motif, 17 NA NM_139057.2 No/No FUSION pENTR223.1 bacterial:spectinomycin
8 HsCD00303115 Plasmid Details cDNA ADAMTS16 a disintegrin-like and metalloprotease (reprolysin type) with thrombospondin type 1 motif, 16 NA NM_139056 No/No FUSION pANT7_cGST bacterial:ampicillin
9 HsCD00303117 Plasmid Details cDNA ADAMTS14 a disintegrin-like and metalloprotease (reprolysin type) with thrombospondin type 1 motif, 14 NA NM_139155 No/No FUSION pANT7_cGST bacterial:ampicillin
10 HsCD00358354 Plasmid Details cDNA POFUT2 protein O-fucosyltransferase 2 partial cds (N-terminal deletion) BC064623 Yes/No CLOSED pDONR221 bacterial:kanamycin
11 HsCD00399153 Plasmid Details cDNA ADAMTS13 ADAM metallopeptidase with thrombospondin type 1 motif, 13 NA BC172369 No/No CLOSED pENTR223.1 bacterial:spectinomycin
12 HsCD00399417 Plasmid Details cDNA ADAMTSL1 ADAMTS-like 1 NA JF432178 No/No FUSION pDONR223 bacterial:spectinomycin
13 HsCD00404466 Plasmid Details cDNA ADAMTSL1 ADAMTS-like 1 NA JF432178 No/No FUSION pANT7_cGST bacterial:ampicillin
14 HsCD00413092 Plasmid Details cDNA POFUT2 protein O-fucosyltransferase 2 partial cds (N-terminal deletion) BC064623 Yes/No CLOSED pGEn2-DEST bacterial:ampicillin
15 HsCD00413271 Plasmid Details cDNA POFUT2 protein O-fucosyltransferase 2 partial cds (N-terminal deletion) BC064623 Yes/No CLOSED pGEn1-DEST bacterial:ampicillin
16 HsCD00413757 Plasmid Details cDNA POFUT2 protein O-fucosyltransferase 2 NA BC064623 No/No FUSION pGEc1-DEST bacterial:ampicillin
17 HsCD00434298 Plasmid Details cDNA ADAMTS1 ADAM metallopeptidase with thrombospondin type 1 motif, 1 NA EU176454 No/No FUSION pLX304 mammalian:blasticidin
18 HsCD00434627 Plasmid Details cDNA SPON2 spondin 2, extracellular matrix protein NA No/Yes FUSION pLX304 mammalian:blasticidin
19 HsCD00436685 Plasmid Details cDNA ADAMTSL1 ADAMTS-like 1 NA JF432178 No/No FUSION pLX304 mammalian:blasticidin
20 HsCD00438344 Plasmid Details cDNA THSD4 thrombospondin, type I, domain containing 4 NA No/No FUSION pLX304 mammalian:blasticidin
21 HsCD00438640 Plasmid Details cDNA CFP complement factor properdin NA DQ896310 No/No FUSION pLX304 mammalian:blasticidin
22 HsCD00439244 Plasmid Details cDNA ADAMTS4 ADAM metallopeptidase with thrombospondin type 1 motif, 4 NA No/No FUSION pLX304 mammalian:blasticidin
23 HsCD00439266 Plasmid Details cDNA ADAMTS12 ADAM metallopeptidase with thrombospondin type 1 motif, 12 NA No/Yes FUSION pLX304 mammalian:blasticidin
24 HsCD00442668 Plasmid Details cDNA ADAMTS18 ADAM metallopeptidase with thrombospondin type 1 motif, 18 NA No/No FUSION pLX304 mammalian:blasticidin
25 HsCD00443178 Plasmid Details cDNA ADAMTS15 ADAM metallopeptidase with thrombospondin type 1 motif, 15 NA No/No FUSION pLX304 mammalian:blasticidin
26 HsCD00451101 Plasmid Details cDNA POFUT2 protein O-fucosyltransferase 2 NA BC064623 No/No FUSION pDONR221 bacterial:kanamycin
27 HsCD00505891 Plasmid Details cDNA ADAMTS1 ADAM metallopeptidase with thrombospondin type 1 motif, 1 NA EU176454 No/No FUSION pENTR223 bacterial:spectinomycin
28 HsCD00505946 Plasmid Details cDNA ADAMTS15 ADAM metallopeptidase with thrombospondin type 1 motif, 15 NA No/No FUSION pENTR223 bacterial:spectinomycin
29 HsCD00509491 Plasmid Details cDNA ADAMTS12 ADAM metallopeptidase with thrombospondin type 1 motif, 12 NA No/Yes FUSION pENTR223 bacterial:spectinomycin
30 HsCD00510131 Plasmid Details cDNA ADAMTS4 ADAM metallopeptidase with thrombospondin type 1 motif, 4 NA No/No FUSION pENTR223 bacterial:spectinomycin
31 HsCD00512191 Plasmid Details cDNA ADAMTSL1 ADAMTS-like 1 NA JF432178 No/No FUSION pENTR223 bacterial:spectinomycin
32 HsCD00512221 Plasmid Details cDNA CFP complement factor properdin NA DQ896310 No/No FUSION pENTR223 bacterial:spectinomycin
33 HsCD00512378 Plasmid Details cDNA THSD4 thrombospondin, type I, domain containing 4 NA No/No FUSION pENTR223 bacterial:spectinomycin
34 HsCD00514641 Plasmid Details cDNA ADAMTS18 ADAM metallopeptidase with thrombospondin type 1 motif, 18 NA No/No FUSION pENTR223 bacterial:spectinomycin
35 HsCD00515090 Plasmid Details cDNA C8orf84 chromosome 8 open reading frame 84 NA No/No FUSION pENTR223 bacterial:spectinomycin
36 HsCD00516296 Plasmid Details cDNA SPON1 spondin 1, extracellular matrix protein NA No/No FUSION pENTR223 bacterial:spectinomycin
37 HsCD00516420 Plasmid Details cDNA THBS2 thrombospondin 2 NA No/No FUSION pENTR223 bacterial:spectinomycin
38 HsCD00521151 Plasmid Details cDNA POFUT2 protein O-fucosyltransferase 2 full-length cds BC064623 No/No FUSION pGEc2-DEST bacterial:ampicillin
39 HsCD00522414 Plasmid Details cDNA POFUT2 protein O-fucosyltransferase 2 partial cds in BC000582 BC064623 Yes/No CLOSED pGEn3-DEST bacterial:ampicillin
40 HsCD00628883 Plasmid Details cDNA ADAMTS18 ADAM metallopeptidase with thrombospondin type 1 motif, 18 NA No/No FUSION pANT7_cGST bacterial:ampicillin
41 HsCD00629371 Plasmid Details cDNA THSD4 thrombospondin, type I, domain containing 4 NA No/No FUSION pANT7_cGST bacterial:ampicillin
42 HsCD00629445 Plasmid Details cDNA ADAMTS4 ADAM metallopeptidase with thrombospondin type 1 motif, 4 NA No/No FUSION pANT7_cGST bacterial:ampicillin
43 HsCD00631100 Plasmid Details cDNA SPON1 spondin 1, extracellular matrix protein NA No/No FUSION pANT7_cGST bacterial:ampicillin
44 HsCD00639161 Plasmid Details cDNA ADAMTS12 ADAM metallopeptidase with thrombospondin type 1 motif, 12 NA No/No FUSION pANT7_cGST bacterial:ampicillin
45 HsCD00640524 Plasmid Details cDNA SBSPON somatomedin B and thrombospondin, type 1 domain containing NA NM_153225 No/No FUSION pANT7_cGST bacterial:ampicillin
46 HsCD00640644 Plasmid Details cDNA POFUT2 protein O-fucosyltransferase 2 NA NM_133635 No/No FUSION pANT7_cGST bacterial:ampicillin
47 HsCD00641008 Plasmid Details cDNA ADAMTS17 ADAM metallopeptidase with thrombospondin type 1 motif, 17 NA NM_139057 No/No FUSION pANT7_cGST bacterial:ampicillin
48 HsCD00641466 Plasmid Details cDNA THBS2 thrombospondin 2 NA NM_003247 No/No FUSION pANT7_cGST bacterial:ampicillin
49 HsUT00698463 Plasmid Details 3'UTR UIMC1 ubiquitin interaction motif containing 1 Sequence Verified: Yes; 3'UTR length: 457; Forward Primer: AGAGGAAGAAGGAGAAAATTCTGA; Reverse Primer: GGAATTGTGCAGTACACATTAAGTGAATAT NM_016290 No/No NA P2RP3 bacterial:kanamycin
50 HsCD00734582 Plasmid Details cDNA ADAMTS15 ADAM metallopeptidase with thrombospondin type 1 motif, 15 NA NM_139055 No/No FUSION pANT7_cGST bacterial:ampicillin
No of Result Per Page : Page: