DNASU Plasmid Repository • 480.965.5697 | Email

Pathways Results


Pathway : Adrenoceptors, 27 clones found

No of Result Per Page : Page: Explanation of Terms
Plasmid ID
Keywords Reference
Vector Selection
1 HsCD00021574 Plasmid Details cDNA ADRA2A adrenergic, alpha-2A-, receptor NA BC050414 No/No FUSION pDNR-Dual bacterial:ampicillin
2 HsCD00292908 Plasmid Details cDNA ADRA2A Alpha-2A adrenergic receptor NA NP_000672 No/No CLOSED pJ2 bacterial:kanamycin
3 HsCD00292909 Plasmid Details cDNA ADRA2A adrenergic, alpha-2A-, receptor NA NP_000672 No/No CLOSED pJ2 bacterial:kanamycin
4 HsCD00292910 Plasmid Details cDNA ADRA2A adrenergic, alpha-2A-, receptor NA NP_000672 No/No CLOSED pJ2 bacterial:kanamycin
5 HsCD00292924 Plasmid Details cDNA ADRB2 Beta-2 adrenergic receptor NA NP_000015 No/No CLOSED pJ2 bacterial:kanamycin
6 HsCD00292925 Plasmid Details cDNA ADRB2 adrenergic, beta-2-, receptor, surface NA NP_000015 No/No CLOSED pJ2 bacterial:kanamycin
7 HsCD00292938 Plasmid Details cDNA ADRB2 Beta-2 adrenergic receptor NA NP_000015 No/No CLOSED pET28a bacterial:kanamycin
8 HsCD00292942 Plasmid Details cDNA ADRB2 adrenergic, beta-2-, receptor, surface NA NP_000015 No/No CLOSED pET28a bacterial:kanamycin
9 HsCD00292946 Plasmid Details cDNA ADRB2 adrenergic, beta-2-, receptor, surface NA NP_000015 No/No CLOSED pET28a bacterial:kanamycin
10 HsCD00292947 Plasmid Details cDNA ADRB2 adrenergic, beta-2-, receptor, surface NA NP_000015 No/No CLOSED pJ2 bacterial:kanamycin
11 HsCD00297084 Plasmid Details cDNA ADRA1D adrenergic, alpha-1D-, receptor NA NM_000678.2 No/No FUSION pENTR223.1 bacterial:spectinomycin
12 HsCD00300158 Plasmid Details cDNA ADRA2A adrenergic, alpha-2A-, receptor NA BC050414 No/No FUSION pLDNT7_nFLAG bacterial:ampicillin
13 HsCD00304880 Plasmid Details cDNA ADRB2 adrenergic, beta-2-, receptor, surface NA NM_000024 Unknown/Unknown FUSION pDONR201 bacterial:kanamycin
14 HsCD00304993 Plasmid Details cDNA ADRA2B adrenergic, alpha-2B-, receptor NA NM_000682 Unknown/Unknown FUSION pDONR201 bacterial:kanamycin
15 HsCD00304994 Plasmid Details cDNA ADRA1A adrenergic, alpha-1A-, receptor NA NM_000680 Unknown/Unknown FUSION pDONR201 bacterial:kanamycin
16 HsCD00304995 Plasmid Details cDNA ADRA1D adrenergic, alpha-1D-, receptor NA NM_000678 Unknown/Unknown FUSION pDONR201 bacterial:kanamycin
17 HsCD00305465 Plasmid Details cDNA ADRB2 adrenergic, beta-2-, receptor, surface NA NM_000024 Unknown/Unknown FUSION pANT7_cGST bacterial:ampicillin
18 HsCD00439646 Plasmid Details cDNA ADRB2 adrenergic, beta-2-, receptor, surface NA No/No FUSION pLX304 mammalian:blasticidin
19 HsCD00505371 Plasmid Details cDNA ADRB2 adrenergic, beta-2-, receptor, surface NA No/No FUSION pENTR223 bacterial:spectinomycin
20 HsCD00515600 Plasmid Details cDNA ADRB3 adrenergic, beta-3-, receptor NA No/No FUSION pENTR223 bacterial:spectinomycin
21 HsCD00515699 Plasmid Details cDNA ADRA2B adrenergic, alpha-2B-, receptor NA No/No FUSION pENTR223 bacterial:spectinomycin
22 HsCD00630859 Plasmid Details cDNA ADRB3 adrenoceptor beta 3 NA No/No FUSION pANT7_cGST bacterial:ampicillin
23 HsCD00651499 Plasmid Details cDNA ADRB2 adrenoceptor beta 2, surface BRIL fusion NM_000024 No/No CLOSED pFASTBAC1 bacterial:ampicillin
24 HsUT00698893 Plasmid Details 3'UTR HHAT hedgehog acyltransferase Sequence Verified: Yes; 3'UTR length: 2097; Forward Primer: GACCTACGCCACGGACTA; Reverse Primer: GCACCACCATTCAGAGTAACTACAAGATTT NM_001122834 No/No NA P2RP3 bacterial:kanamycin
25 HsCD00731745 Plasmid Details cDNA ADRA2B adrenoceptor alpha 2B NA NM_000682 No/No FUSION pANT7_cGST bacterial:ampicillin
26 HsCD00731746 Plasmid Details cDNA ADRA1A adrenoceptor alpha 1A NA NM_000680 No/No FUSION pANT7_cGST bacterial:ampicillin
27 HsCD00731747 Plasmid Details cDNA ADRA1D adrenoceptor alpha 1D NA NM_000678 No/No FUSION pANT7_cGST bacterial:ampicillin
No of Result Per Page : Page: