DNASU Plasmid Repository • 480.965.5697 | Email

Pathways Results

TOP

Pathway : Opsins, 36 clones found

No of Result Per Page : Page: Explanation of Terms
  DNASU
Plasmid ID
Clone
Type
Gene
Symbol
Gene
Name
Keywords Reference
Sequence
Mutation/
Discrepancy
Insert
Format
Vector Selection
Markers
 
1 HsCD00041029 Plasmid Details cDNA RGR retinal G protein coupled receptor NA BC011349 No/No FUSION pDONR221 bacterial:kanamycin
2 HsCD00044147 Plasmid Details cDNA RGR retinal G protein coupled receptor NA BC011349 No/No CLOSED pDONR221 bacterial:kanamycin
3 HsCD00078015 Plasmid Details cDNA RGR retinal G protein coupled receptor NA BC011349 No/No FUSION pANT7_cGST bacterial:ampicillin
4 HsCD00082470 Plasmid Details cDNA RHO rhodopsin (opsin 2, rod pigment) (retinitis pigmentosa 4, autosomal dominant) NA BX537381 No/No FUSION pDONR201 bacterial:kanamycin
5 HsCD00082613 Plasmid Details cDNA RHO rhodopsin (opsin 2, rod pigment) (retinitis pigmentosa 4, autosomal dominant) NA BC111451 No/No FUSION pENTR223.1 bacterial:spectinomycin
6 HsCD00082748 Plasmid Details cDNA OPN1LW opsin 1 (cone pigments), long-wave-sensitive (color blindness, protan) NA NM_020061 No/No CLOSED pENTR223.1 bacterial:spectinomycin
7 HsCD00082755 Plasmid Details cDNA OPN1MW opsin 1 (cone pigments), medium-wave-sensitive (color blindness, deutan) NA NM_000513 No/No CLOSED pENTR223.1 bacterial:spectinomycin
8 HsCD00082822 Plasmid Details cDNA OPN1SW opsin 1 (cone pigments), short-wave-sensitive (color blindness, tritan) NA NM_001708 No/No CLOSED pENTR223.1 bacterial:spectinomycin
9 HsCD00297092 Plasmid Details cDNA OPN1LW opsin 1 (cone pigments), long-wave-sensitive NA NM_020061.3 No/No FUSION pENTR223.1 bacterial:spectinomycin
10 HsCD00297178 Plasmid Details cDNA OPN1SW opsin 1 (cone pigments), short-wave-sensitive NA NM_001708.1 No/No FUSION pENTR223.1 bacterial:spectinomycin
11 HsCD00297184 Plasmid Details cDNA OPN1MW opsin 1 (cone pigments), medium-wave-sensitive NA NM_000513.1 No/No FUSION pENTR223.1 bacterial:spectinomycin
12 HsCD00305162 Plasmid Details cDNA OPN3 opsin 3 (encephalopsin, panopsin) NA NM_014322 Unknown/Unknown FUSION pDONR201 bacterial:kanamycin
13 HsCD00350419 Plasmid Details cDNA OPN1LW opsin 1 (cone pigments), long-wave-sensitive NA BC156643 No/No CLOSED pENTR223.1 bacterial:spectinomycin
14 HsCD00350428 Plasmid Details cDNA OPN1MW opsin 1 (cone pigments), medium-wave-sensitive NA BC156776 No/No CLOSED pENTR223.1 bacterial:spectinomycin
15 HsCD00350502 Plasmid Details cDNA OPN1SW opsin 1 (cone pigments), short-wave-sensitive NA BC156719 No/No CLOSED pENTR223.1 bacterial:spectinomycin
16 HsCD00351471 Plasmid Details cDNA RHO rhodopsin NA AM392780 No/No FUSION pENTR201 bacterial:kanamycin
17 HsCD00353588 Plasmid Details cDNA OPN5 opsin 5 NA HQ258199 No/No FUSION pDONR223 bacterial:spectinomycin
18 HsCD00402821 Plasmid Details cDNA RHO rhodopsin NA AM392780 No/No FUSION pANT7_cGST bacterial:ampicillin
19 HsCD00403364 Plasmid Details cDNA OPN5 opsin 5 NA HQ258199 No/No FUSION pANT7_cGST bacterial:ampicillin
20 HsCD00435090 Plasmid Details cDNA OPN3 opsin 3 NA No/No FUSION pLX304 mammalian:blasticidin
21 HsCD00437112 Plasmid Details cDNA OPN5 opsin 5 NA No/Yes FUSION pLX304 mammalian:blasticidin
22 HsCD00440142 Plasmid Details cDNA OPN5 opsin 5 NA HQ258199 No/No FUSION pLX304 mammalian:blasticidin
23 HsCD00441141 Plasmid Details cDNA RGR retinal G protein coupled receptor NA DQ895267 No/No FUSION pLX304 mammalian:blasticidin
24 HsCD00443112 Plasmid Details cDNA OPN4 opsin 4 NA No/No FUSION pLX304 mammalian:blasticidin
25 HsCD00508927 Plasmid Details cDNA RGR retinal G protein coupled receptor NA DQ895267 No/No FUSION pENTR223 bacterial:spectinomycin
26 HsCD00510710 Plasmid Details cDNA OPN5 opsin 5 NA HQ258199 No/No FUSION pENTR223 bacterial:spectinomycin
27 HsCD00511145 Plasmid Details cDNA OPN3 opsin 3 NA No/No FUSION pENTR223 bacterial:spectinomycin
28 HsCD00512895 Plasmid Details cDNA OPN4 opsin 4 NA No/No FUSION pENTR223 bacterial:spectinomycin
29 HsCD00630737 Plasmid Details cDNA OPN4 opsin 4 NA No/No FUSION pANT7_cGST bacterial:ampicillin
30 HsCD00640983 Plasmid Details cDNA OPN1LW opsin 1 (cone pigments), long-wave-sensitive NA NM_020061 No/No FUSION pANT7_cGST bacterial:ampicillin
31 HsCD00642018 Plasmid Details cDNA OPN1SW opsin 1 (cone pigments), short-wave-sensitive NA NM_001708 No/No FUSION pANT7_cGST bacterial:ampicillin
32 HsCD00674500 Plasmid Details cDNA OPN1MW opsin 1 (cone pigments), medium-wave-sensitive NA BC143790 No/No FUSION pANT7_cGST bacterial:ampicillin
33 HsUT00699362 Plasmid Details 3'UTR RBM15 RNA binding motif protein 15 Sequence Verified: Yes; 3'UTR length: 1252; Forward Primer: AACTTGGCGCTGACCCTGTTATAG; Reverse Primer: TCAGAATTGACACACCGTGATAGTCAAAAT NM_022768 No/No NA P2RP3 bacterial:kanamycin
34 HsCD00718559 Plasmid Details cDNA OPN1MW opsin 1 (cone pigments), medium-wave-sensitive NA BC143790 No/No FUSION pDONR221 bacterial:kanamycin
35 HsCD00731825 Plasmid Details cDNA OPN3 opsin 3 NA NM_014322 No/No FUSION pANT7_cGST bacterial:ampicillin
36 HsCD00731890 Plasmid Details cDNA RHO rhodopsin NA BX537381 No/No FUSION pANT7_cGST bacterial:ampicillin
No of Result Per Page : Page: