DNASU Plasmid Repository • 480.965.5697 | Email

Pathways Results


Pathway : Organic anion transport, 24 clones found

No of Result Per Page : Page: Explanation of Terms
Plasmid ID
Keywords Reference
Vector Selection
1 HsCD00040969 Plasmid Details cDNA SLC22A8 solute carrier family 22 (organic anion transporter), member 8 NA BC022387 No/No FUSION pDONR221 bacterial:kanamycin
2 HsCD00041035 Plasmid Details cDNA SLC22A6 solute carrier family 22 (organic anion transporter), member 6 NA BC033682 No/No FUSION pDONR221 bacterial:kanamycin
3 HsCD00042530 Plasmid Details cDNA SLC22A7 solute carrier family 22 (organic anion transporter), member 7 NA BC033805 No/No FUSION pDONR221 bacterial:kanamycin
4 HsCD00044090 Plasmid Details cDNA SLC22A8 solute carrier family 22 (organic anion transporter), member 8 NA BC022387 No/No CLOSED pDONR221 bacterial:kanamycin
5 HsCD00044153 Plasmid Details cDNA SLC22A6 solute carrier family 22 (organic anion transporter), member 6 NA BC033682 No/No CLOSED pDONR221 bacterial:kanamycin
6 HsCD00045631 Plasmid Details cDNA SLC22A7 solute carrier family 22 (organic anion transporter), member 7 NA BC033805 No/No CLOSED pDONR221 bacterial:kanamycin
7 HsCD00075918 Plasmid Details cDNA SLC22A11 solute carrier family 22 (organic anion/cation transporter), member 11 NA BC034384 No/No FUSION pDONR221 bacterial:kanamycin
8 HsCD00075919 Plasmid Details cDNA SLC22A11 solute carrier family 22 (organic anion/cation transporter), member 11 NA BC034384 No/No CLOSED pDONR221 bacterial:kanamycin
9 HsCD00077422 Plasmid Details cDNA SLC22A11 solute carrier family 22 (organic anion/cation transporter), member 11 NA BC034384 No/No FUSION pANT7_cGST bacterial:ampicillin
10 HsCD00077954 Plasmid Details cDNA SLC22A7 solute carrier family 22 (organic anion transporter), member 7 NA BC033805 No/No FUSION pANT7_cGST bacterial:ampicillin
11 HsCD00435400 Plasmid Details cDNA SLC22A6 solute carrier family 22 (organic anion transporter), member 6 NA DQ895273 No/No FUSION pLX304 mammalian:blasticidin
12 HsCD00437545 Plasmid Details cDNA SLC22A11 solute carrier family 22 (organic anion/urate transporter), member 11 NA EU176504 No/No FUSION pLX304 mammalian:blasticidin
13 HsCD00438968 Plasmid Details cDNA SLC22A12 solute carrier family 22 (organic anion/urate transporter), member 12 NA No/No FUSION pLX304 mammalian:blasticidin
14 HsCD00442527 Plasmid Details cDNA SLC22A7 solute carrier family 22 (organic anion transporter), member 7 NA DQ896844 No/No FUSION pLX304 mammalian:blasticidin
15 HsCD00513308 Plasmid Details cDNA SLC22A6 solute carrier family 22 (organic anion transporter), member 6 NA DQ895273 No/No FUSION pENTR223 bacterial:spectinomycin
16 HsCD00513313 Plasmid Details cDNA SLC22A12 solute carrier family 22 (organic anion/urate transporter), member 12 NA No/No FUSION pENTR223 bacterial:spectinomycin
17 HsCD00513341 Plasmid Details cDNA SLC22A7 solute carrier family 22 (organic anion transporter), member 7 NA DQ896844 No/No FUSION pENTR223 bacterial:spectinomycin
18 HsCD00513892 Plasmid Details cDNA SLC22A11 solute carrier family 22 (organic anion/urate transporter), member 11 NA EU176504 No/No FUSION pENTR223 bacterial:spectinomycin
19 HsCD00583113 Plasmid Details cDNA SLC22A6 solute carrier family 22 (organic anion transporter), member 6 NA No/No FUSION pPICZa bacterial:zeocin
20 HsCD00620985 Plasmid Details cDNA SLC22A6 solute carrier family 22 (organic anion transporter), member 6 NA BC033682 No/No FUSION pANT7_cGST bacterial:ampicillin
21 HsCD00627288 Plasmid Details cDNA SLC22A8 solute carrier family 22 (organic anion transporter), member 8 codon-optimized sequence No/No CLOSED pPICZa bacterial:zeocin
22 HsCD00640106 Plasmid Details cDNA SLC22A12 solute carrier family 22 (organic anion/urate transporter), member 12 NA NM_144585 No/No FUSION pANT7_cGST bacterial:ampicillin
23 HsUT00699233 Plasmid Details 3'UTR JMJD1B lysine (K)-specific demethylase 3B Sequence Verified: Yes; 3'UTR length: 1507; Forward Primer: GAATCCAAACTGGCAAGGTCCTAG; Reverse Primer: AACATGGCACAGTCTCAACAAGCAA NM_016604 No/No NA P2RP3 bacterial:kanamycin
24 HsCD00731151 Plasmid Details cDNA SLC22A8 solute carrier family 22 (organic anion transporter), member 8 NA BC022387 No/No FUSION pANT7_cGST bacterial:ampicillin
No of Result Per Page : Page: