DNASU Plasmid Repository • 480.965.5697 | Email

Pathways Results


Pathway : Organic anion transporters, 24 clones found

No of Result Per Page : Page: Explanation of Terms
Plasmid ID
Keywords Reference
Vector Selection
1 HsCD00042278 Plasmid Details cDNA SLC25A10 solute carrier family 25 (mitochondrial carrier; dicarboxylate transporter), member 10 NA BC007355 No/No FUSION pDONR221 bacterial:kanamycin
2 HsCD00043479 Plasmid Details cDNA SLC17A5 solute carrier family 17 (anion/sugar transporter), member 5 NA BC020961 No/No CLOSED pDONR221 bacterial:kanamycin
3 HsCD00045280 Plasmid Details cDNA SLC25A10 solute carrier family 25 (mitochondrial carrier; dicarboxylate transporter), member 10 NA BC007355 No/No CLOSED pDONR221 bacterial:kanamycin
4 HsCD00076016 Plasmid Details cDNA SLC17A5 solute carrier family 17 (anion/sugar transporter), member 5 NA BC020961 No/No FUSION pDONR221 bacterial:kanamycin
5 HsCD00300869 Plasmid Details cDNA SLC17A5 solute carrier family 17 (anion/sugar transporter), member 5 NA BC020961 No/No FUSION pANT7_cGST bacterial:ampicillin
6 HsCD00398484 Plasmid Details cDNA SLC17A8 solute carrier family 17 (sodium-dependent inorganic phosphate cotransporter), member 8 NA HQ258284 No/No FUSION pDONR223 bacterial:spectinomycin
7 HsCD00404027 Plasmid Details cDNA SLC17A8 solute carrier family 17 (sodium-dependent inorganic phosphate cotransporter), member 8 NA HQ258284 No/No FUSION pANT7_cGST bacterial:ampicillin
8 HsCD00441126 Plasmid Details cDNA SLC25A10 solute carrier family 25 (mitochondrial carrier; dicarboxylate transporter), member 10 NA DQ896592 No/No FUSION pLX304 mammalian:blasticidin
9 HsCD00443751 Plasmid Details cDNA SLC25A10 solute carrier family 25 (mitochondrial carrier; dicarboxylate transporter), member 10 NA DQ896592 No/No FUSION pLX304 mammalian:blasticidin
10 HsCD00446540 Plasmid Details cDNA SLC5A8 solute carrier family 5 (iodide transporter), member 8 NA No/No FUSION pLX304 mammalian:blasticidin
11 HsCD00446621 Plasmid Details cDNA SLC17A8 solute carrier family 17 (sodium-dependent inorganic phosphate cotransporter), member 8 NA HQ258284 No/No FUSION pLX304 mammalian:blasticidin
12 HsCD00508859 Plasmid Details cDNA SLC25A10 solute carrier family 25 (mitochondrial carrier; dicarboxylate transporter), member 10 NA DQ896592 No/No FUSION pENTR223 bacterial:spectinomycin
13 HsCD00508995 Plasmid Details cDNA SLC25A10 solute carrier family 25 (mitochondrial carrier; dicarboxylate transporter), member 10 NA DQ896592 No/No FUSION pENTR223 bacterial:spectinomycin
14 HsCD00513286 Plasmid Details cDNA SLC17A8 solute carrier family 17 (sodium-dependent inorganic phosphate cotransporter), member 8 NA HQ258284 No/No FUSION pENTR223 bacterial:spectinomycin
15 HsCD00514235 Plasmid Details cDNA SLC5A8 solute carrier family 5 (iodide transporter), member 8 NA No/No FUSION pENTR223 bacterial:spectinomycin
16 HsCD00516188 Plasmid Details cDNA SLC5A5 solute carrier family 5 (sodium iodide symporter), member 5 NA No/No FUSION pENTR223 bacterial:spectinomycin
17 HsCD00627291 Plasmid Details cDNA SLC5A5 solute carrier family 5 (sodium/iodide cotransporter), member 5 codon-optimized sequence No/No CLOSED pPICZa bacterial:zeocin
18 HsCD00641148 Plasmid Details cDNA SLC5A8 solute carrier family 5 (sodium/monocarboxylate cotransporter), member 8 NA NM_145913 No/No FUSION pANT7_cGST bacterial:ampicillin
19 HsCD00673969 Plasmid Details cDNA SLC17A8 solute carrier family 17 (vesicular glutamate transporter), member 8 NA BC117229 No/No FUSION pANT7_cGST bacterial:ampicillin
20 HsUT00699209 Plasmid Details 3'UTR GRHL3 grainyhead-like 3 (Drosophila) Sequence Verified: Yes; 3'UTR length: 1010; Forward Primer: AAAATTCAGATCATCCTTAAGGAGCTGTAA; Reverse Primer: GCCCTGCACGTCCCAGCA NM_021180 No/No NA P2RP3 bacterial:kanamycin
21 HsCD00718598 Plasmid Details cDNA SLC17A8 solute carrier family 17 (vesicular glutamate transporter), member 8 NA BC117229 No/No FUSION pDONR221 bacterial:kanamycin
22 HsCD00730916 Plasmid Details cDNA SLC25A10 solute carrier family 25 (mitochondrial carrier; dicarboxylate transporter), member 10 NA BC007355 No/No FUSION pANT7_cGST bacterial:ampicillin
23 HsCD00734605 Plasmid Details cDNA SLC5A5 solute carrier family 5 (sodium/iodide cotransporter), member 5 NA NM_000453 No/No FUSION pANT7_cGST bacterial:ampicillin
24 HsCD00817353 Plasmid Details cDNA SLC25A10 solute carrier family 25 member 10 "insert_ID 28971,DNASU_Clone_ID HsCD00042278" BC007355 No/No FUSION pJFT7_nHalo_DC(r4) bacterial:ampicillin
No of Result Per Page : Page: