DNASU Plasmid Repository • 480.965.5697 | Email

Pathways Results

TOP

Pathway : Organic cation transport, 32 clones found

No of Result Per Page : Page: Explanation of Terms
  DNASU
Plasmid ID
Clone
Type
Gene
Symbol
Gene
Name
Keywords Reference
Sequence
Mutation/
Discrepancy
Insert
Format
Vector Selection
Markers
 
1 HsCD00039658 Plasmid Details cDNA SLC22A4 solute carrier family 22 (organic cation transporter), member 4 NA BC028313 No/No FUSION pDONR221 bacterial:kanamycin
2 HsCD00041326 Plasmid Details cDNA SLC22A15 solute carrier family 22 (organic cation transporter), member 15 NA BC026358 No/No FUSION pDONR221 bacterial:kanamycin
3 HsCD00041557 Plasmid Details cDNA SLC22A5 solute carrier family 22 (organic cation transporter), member 5 NA BC012325 No/No FUSION pDONR221 bacterial:kanamycin
4 HsCD00042833 Plasmid Details cDNA SLC22A4 solute carrier family 22 (organic cation transporter), member 4 NA BC028313 No/Yes CLOSED pDONR221 bacterial:kanamycin
5 HsCD00044430 Plasmid Details cDNA SLC22A15 solute carrier family 22 (organic cation transporter), member 15 NA BC026358 No/No CLOSED pDONR221 bacterial:kanamycin
6 HsCD00045688 Plasmid Details cDNA SLC22A5 solute carrier family 22 (organic cation transporter), member 5 NA BC012325 No/No CLOSED pDONR221 bacterial:kanamycin
7 HsCD00076298 Plasmid Details cDNA SLC22A18 solute carrier family 22 (organic cation transporter), member 18 NA BC015571 No/No FUSION pDONR221 bacterial:kanamycin
8 HsCD00398461 Plasmid Details cDNA SLC22A1 solute carrier family 22 (organic cation transporter), member 1 NA HQ258293 No/No FUSION pDONR223 bacterial:spectinomycin
9 HsCD00400001 Plasmid Details cDNA SLC22A16 solute carrier family 22 (organic cation/carnitine transporter), member 16 NA JF432782 No/No FUSION pDONR223 bacterial:spectinomycin
10 HsCD00404006 Plasmid Details cDNA SLC22A1 solute carrier family 22 (organic cation transporter), member 1 NA HQ258293 No/No FUSION pANT7_cGST bacterial:ampicillin
11 HsCD00404955 Plasmid Details cDNA SLC22A16 solute carrier family 22 (organic cation/carnitine transporter), member 16 NA JF432782 No/No FUSION pANT7_cGST bacterial:ampicillin
12 HsCD00438023 Plasmid Details cDNA SLC22A18 solute carrier family 22, member 18 NA EU176788 No/No FUSION pLX304 mammalian:blasticidin
13 HsCD00438834 Plasmid Details cDNA SLC22A16 solute carrier family 22 (organic cation/carnitine transporter), member 16 NA JF432782 No/No FUSION pLX304 mammalian:blasticidin
14 HsCD00441733 Plasmid Details cDNA SLC22A5 solute carrier family 22 (organic cation/carnitine transporter), member 5 NA DQ895818 No/No FUSION pLX304 mammalian:blasticidin
15 HsCD00442957 Plasmid Details cDNA SLC22A2 solute carrier family 22 (organic cation transporter), member 2 NA No/No FUSION pLX304 mammalian:blasticidin
16 HsCD00442984 Plasmid Details cDNA SLC22A4 solute carrier family 22 (organic cation/ergothioneine transporter), member 4 NA DQ893972 No/No FUSION pLX304 mammalian:blasticidin
17 HsCD00445174 Plasmid Details cDNA SLC22A15 solute carrier family 22, member 15 NA DQ895576 No/No FUSION pLX304 mammalian:blasticidin
18 HsCD00446595 Plasmid Details cDNA SLC22A1 solute carrier family 22 (organic cation transporter), member 1 NA HQ258293 No/No FUSION pLX304 mammalian:blasticidin
19 HsCD00511807 Plasmid Details cDNA SLC22A18 solute carrier family 22, member 18 NA EU176788 No/No FUSION pENTR223 bacterial:spectinomycin
20 HsCD00512604 Plasmid Details cDNA SLC22A4 solute carrier family 22 (organic cation/ergothioneine transporter), member 4 NA DQ893972 No/No FUSION pENTR223 bacterial:spectinomycin
21 HsCD00513272 Plasmid Details cDNA SLC22A15 solute carrier family 22, member 15 NA DQ895576 No/No FUSION pENTR223 bacterial:spectinomycin
22 HsCD00513330 Plasmid Details cDNA SLC22A5 solute carrier family 22 (organic cation/carnitine transporter), member 5 NA DQ895818 No/No FUSION pENTR223 bacterial:spectinomycin
23 HsCD00513368 Plasmid Details cDNA SLC22A1 solute carrier family 22 (organic cation transporter), member 1 NA HQ258293 No/No FUSION pENTR223 bacterial:spectinomycin
24 HsCD00513846 Plasmid Details cDNA SLC22A2 solute carrier family 22 (organic cation transporter), member 2 NA No/No FUSION pENTR223 bacterial:spectinomycin
25 HsCD00513971 Plasmid Details cDNA SLC22A16 solute carrier family 22 (organic cation/carnitine transporter), member 16 NA JF432782 No/No FUSION pENTR223 bacterial:spectinomycin
26 HsCD00583114 Plasmid Details cDNA SLC22A1 solute carrier family 22 (organic cation transporter), member 1 NA No/No FUSION pPICZa bacterial:zeocin
27 HsCD00603860 Plasmid Details cDNA SLC22A15 solute carrier family 22, member 15 NA BC026358 No/No FUSION pANT7_cGST bacterial:ampicillin
28 HsCD00627294 Plasmid Details cDNA SLC22A2 solute carrier family 22 (organic cation transporter), member 2 codon-optimized sequence No/Yes CLOSED pPICZa bacterial:zeocin
29 HsCD00639140 Plasmid Details cDNA SLC22A2 solute carrier family 22 (organic cation transporter), member 2 NA No/No FUSION pANT7_cGST bacterial:ampicillin
30 HsUT00699386 Plasmid Details 3'UTR ZNF860 zinc finger protein 860 Sequence Verified: Yes; 3'UTR length: 938; Forward Primer: AAGCGTGGCAAGGTCTTCAGTTAG; Reverse Primer: GCACCTGGCATTTTTTTTTTTTTAGCCT NM_001137674 No/No NA P2RP3 bacterial:kanamycin
31 HsCD00731021 Plasmid Details cDNA SLC22A5 solute carrier family 22 (organic cation/carnitine transporter), member 5 NA BC012325 No/No FUSION pANT7_cGST bacterial:ampicillin
32 HsCD00731314 Plasmid Details cDNA SLC22A4 solute carrier family 22 (organic cation/zwitterion transporter), member 4 NA BC028313 No/No FUSION pANT7_cGST bacterial:ampicillin
No of Result Per Page : Page: