DNASU Plasmid Repository • 480.965.5697 | Email

Pathways Results

TOP

Pathway : Alpha6 beta4 integrin-ligand interactions, 11 clones found

No of Result Per Page : Page: Explanation of Terms
  DNASU
Plasmid ID
Clone
Type
Gene
Symbol
Gene
Name
Keywords Reference
Sequence
Mutation/
Discrepancy
Insert
Format
Vector Selection
Markers
 
1 HsCD00022037 Plasmid Details cDNA LAMA5 laminin, alpha 5 potential short variant BC003355 No/No FUSION pDNR-Dual bacterial:ampicillin
2 HsCD00295582 Plasmid Details cDNA LAMB3 laminin, beta 3 NA BC075838.1 No/No CLOSED pDONR221 bacterial:kanamycin
3 HsCD00295674 Plasmid Details cDNA LAMB3 laminin, beta 3 NA BC075838.1 No/No FUSION pDONR221 bacterial:kanamycin
4 HsCD00353992 Plasmid Details cDNA LAMA2 laminin, alpha 2 NA BC172564 No/No CLOSED pENTR223.1 bacterial:spectinomycin
5 HsCD00399186 Plasmid Details cDNA LAMA3 laminin, alpha 3 NA BC172402 No/No CLOSED pENTR223.1 bacterial:spectinomycin
6 HsCD00442171 Plasmid Details cDNA LAMC1 laminin, gamma 1 (formerly LAMB2) NA No/No FUSION pLX304 mammalian:blasticidin
7 HsCD00504245 Plasmid Details cDNA LAMC1 laminin, gamma 1 (formerly LAMB2) NA No/No FUSION pENTR223 bacterial:spectinomycin
8 HsCD00516505 Plasmid Details cDNA ITGA6 integrin, alpha 6 NA No/No FUSION pENTR223 bacterial:spectinomycin
9 HsCD00641199 Plasmid Details cDNA LAMB3 laminin, beta 3 NA BC075838 No/No FUSION pANT7_cGST bacterial:ampicillin
10 HsUT00698866 Plasmid Details 3'UTR BCL11A B-cell CLL/lymphoma 11A (zinc finger protein) Sequence Verified: Yes; 3'UTR length: 1588; Forward Primer: TCGAGAGCCCTTAAGTTCTGA; Reverse Primer: TCTCTTACTGATGTGGCCTCTGG NM_018014 No/No NA P2RP3 bacterial:kanamycin
11 HsCD00734647 Plasmid Details cDNA ITGA6 integrin, alpha 6 NA NM_001079818 No/No FUSION pANT7_cGST bacterial:ampicillin
No of Result Per Page : Page: