DNASU Plasmid Repository • 480.965.5697 | Email

Pathways Results

TOP

Pathway : Pre-NOTCH Processing in the Endoplasmic Reticulum, 18 clones found

No of Result Per Page : Page: Explanation of Terms
  DNASU
Plasmid ID
Clone
Type
Gene
Symbol
Gene
Name
Keywords Reference
Sequence
Mutation/
Discrepancy
Insert
Format
Vector Selection
Markers
 
1 HsCD00287785 Plasmid Details cDNA KTELC1 KTEL (Lys-Tyr-Glu-Leu) containing 1 NA BC030614.2 No/No FUSION pENTR223 bacterial:spectinomycin
2 HsCD00353457 Plasmid Details cDNA KTELC1 KTEL (Lys-Tyr-Glu-Leu) containing 1 NA HQ447221 No/No FUSION pDONR223 bacterial:spectinomycin
3 HsCD00357211 Plasmid Details cDNA KTELC1 KTEL (Lys-Tyr-Glu-Leu) containing 1 NA HQ447221 No/No FUSION pANT7_cGST bacterial:ampicillin
4 HsCD00358346 Plasmid Details cDNA POGLUT1 protein O-glucosyltransferase 1 partial cds (N and C terminal deletion) BC030614 Yes/No CLOSED pDONR221 bacterial:kanamycin
5 HsCD00413086 Plasmid Details cDNA POGLUT1 protein O-glucosyltransferase 1 partial cds (N and C terminal deletion) BC030614 Yes/No CLOSED pGEn2-DEST bacterial:ampicillin
6 HsCD00413265 Plasmid Details cDNA POGLUT1 protein O-glucosyltransferase 1 partial cds (N and C terminal deletion) BC030614 Yes/No CLOSED pGEn1-DEST bacterial:ampicillin
7 HsCD00413722 Plasmid Details cDNA POGLUT1 protein O-glucosyltransferase 1 NA BC030614 No/No FUSION pGEc1-DEST bacterial:ampicillin
8 HsCD00437845 Plasmid Details cDNA POFUT1 protein O-fucosyltransferase 1 NA No/No FUSION pLX304 mammalian:blasticidin
9 HsCD00444261 Plasmid Details cDNA POGLUT1 protein O-glucosyltransferase 1 NA HQ447221 No/No FUSION pLX304 mammalian:blasticidin
10 HsCD00451121 Plasmid Details cDNA POGLUT1 protein O-glucosyltransferase 1 NA BC030614 No/No FUSION pDONR221 bacterial:kanamycin
11 HsCD00506765 Plasmid Details cDNA POFUT1 protein O-fucosyltransferase 1 NA No/No FUSION pENTR223 bacterial:spectinomycin
12 HsCD00511101 Plasmid Details cDNA KTELC1 protein O-glucosyltransferase 1 NA HQ447221 No/No FUSION pENTR223 bacterial:spectinomycin
13 HsCD00516490 Plasmid Details cDNA NOTCH2 notch 2 NA No/No FUSION pENTR223 bacterial:spectinomycin
14 HsCD00521170 Plasmid Details cDNA POGLUT1 protein O-glucosyltransferase 1 partial cds (C-terminal deletion) BC030614 No/No FUSION pGEc2-DEST bacterial:ampicillin
15 HsCD00522408 Plasmid Details cDNA POGLUT1 protein O-glucosyltransferase 1 NA BC030614 Yes/No CLOSED pGEn3-DEST bacterial:ampicillin
16 HsCD00639698 Plasmid Details cDNA POFUT1 protein O-fucosyltransferase 1 NA No/No FUSION pANT7_cGST bacterial:ampicillin
17 HsUT00699174 Plasmid Details 3'UTR SETD8 SET domain containing (lysine methyltransferase) 8 Sequence Verified: Yes; 3'UTR length: 1830; Forward Primer: CCGTGGCTGAAGCATTAA; Reverse Primer: TGAGGAAACGAAAGAGCTCAGAGTTC NM_020382 No/No NA P2RP3 bacterial:kanamycin
18 HsCD00732021 Plasmid Details cDNA POGLUT1 protein O-glucosyltransferase 1 NA BC030614 No/No FUSION pANT7_cGST bacterial:ampicillin
No of Result Per Page : Page: