DNASU Plasmid Repository • 480.965.5697 | Email

Pathways Results

TOP

Pathway : Presynaptic phase of homologous DNA pairing and strand exchange, 35 clones found

No of Result Per Page : Page: Explanation of Terms
  DNASU
Plasmid ID
Clone
Type
Gene
Symbol
Gene
Name
Keywords Reference
Sequence
Mutation/
Discrepancy
Insert
Format
Vector Selection
Markers
 
1 HsCD00000299 Plasmid Details cDNA BRCA2 breast cancer 2, early onset NA NM_000059 No/Yes CLOSED pDNR-Dual bacterial:ampicillin
2 HsCD00001689 Plasmid Details cDNA RAD51 RAD51 homolog (RecA homolog, E. coli) (S. cerevisiae) NA D14134 No/No FUSION pDONR201 bacterial:kanamycin
3 HsCD00001690 Plasmid Details cDNA RAD51 RAD51 homolog (RecA homolog, E. coli) (S. cerevisiae) NA D14134 No/No CLOSED pDONR201 bacterial:kanamycin
4 HsCD00001691 Plasmid Details cDNA RAD51 RAD51 homolog (RecA homolog, E. coli) (S. cerevisiae) NA D14134 No/No FUSION pDNR-Dual bacterial:ampicillin
5 HsCD00001692 Plasmid Details cDNA RAD51 RAD51 homolog (RecA homolog, E. coli) (S. cerevisiae) NA D14134 No/No CLOSED pDNR-Dual bacterial:ampicillin
6 HsCD00004169 Plasmid Details cDNA RPA3 replication protein A3, 14kDa NA BC005264 No/No CLOSED pDNR-Dual bacterial:ampicillin
7 HsCD00022259 Plasmid Details cDNA RAD51 RAD51 homolog (RecA homolog, E. coli) (S. cerevisiae) potential short variant BC001459 No/No FUSION pDNR-Dual bacterial:ampicillin
8 HsCD00022260 Plasmid Details cDNA RAD51 RAD51 homolog (RecA homolog, E. coli) (S. cerevisiae) potential short variant BC001459 No/No CLOSED pDNR-Dual bacterial:ampicillin
9 HsCD00022279 Plasmid Details cDNA RAD52 RAD52 homolog (S. cerevisiae) NA U12134 No/Yes FUSION pDONR201 bacterial:kanamycin
10 HsCD00041560 Plasmid Details cDNA RPA2 replication protein A2, 32kDa NA BC001630 No/No FUSION pDONR221 bacterial:kanamycin
11 HsCD00044415 Plasmid Details cDNA RPA2 replication protein A2, 32kDa NA BC001630 No/No CLOSED pDONR221 bacterial:kanamycin
12 HsCD00074854 Plasmid Details cDNA RAD51 RAD51 homolog (RecA homolog, E. coli) (S. cerevisiae) NA D14134 No/No CLOSED pJP1520 mammalian:puromycin
13 HsCD00075689 Plasmid Details cDNA BRCA2 breast cancer 2, early onset NA NM_000059 No/Yes CLOSED pJP1520 mammalian:puromycin
14 HsCD00078624 Plasmid Details cDNA RPA2 replication protein A2, 32kDa NA BC001630 No/No FUSION pANT7_cGST bacterial:ampicillin
15 HsCD00295484 Plasmid Details cDNA RAD52 RAD52 homolog (S. cerevisiae) NA NM_134424.2 No/No CLOSED pENTR223.1 bacterial:spectinomycin
16 HsCD00305195 Plasmid Details cDNA Rad51 RAD51 homolog (RecA homolog, E. coli) (S. cerevisiae) NA D14134.1 Unknown/Unknown FUSION pDONR201 bacterial:kanamycin
17 HsCD00343173 Plasmid Details cDNA RAD52 RAD52 homolog (S. cerevisiae) NA U12134 No/No CLOSED pMCSG7 bacterial:ampicillin
18 HsCD00353697 Plasmid Details cDNA RPA1 replication protein A1, 70kDa NA HQ258560 No/No FUSION pDONR223 bacterial:spectinomycin
19 HsCD00358218 Plasmid Details cDNA RPA2 replication protein A2, 32kDa NA P15927 No/No CLOSED pMCSG7 bacterial:ampicillin
20 HsCD00403449 Plasmid Details cDNA RPA1 replication protein A1, 70kDa NA HQ258560 No/No FUSION pANT7_cGST bacterial:ampicillin
21 HsCD00437663 Plasmid Details cDNA RPA3 replication protein A3, 14kDa NA No/Yes FUSION pLX304 mammalian:blasticidin
22 HsCD00442975 Plasmid Details cDNA RPA1 replication protein A1, 70kDa NA No/Yes FUSION pLX304 mammalian:blasticidin
23 HsCD00444191 Plasmid Details cDNA RPA2 replication protein A2, 32kDa NA DQ895821 No/No FUSION pLX304 mammalian:blasticidin
24 HsCD00508178 Plasmid Details cDNA RPA2 replication protein A2, 32kDa NA DQ895821 No/No FUSION pENTR223 bacterial:spectinomycin
25 HsCD00515033 Plasmid Details cDNA RAD51 RAD51 homolog (S. cerevisiae) NA No/No FUSION pENTR223 bacterial:spectinomycin
26 HsCD00547444 Plasmid Details cDNA RPA3 replication protein A3, 14kDa NA BC009868 No/No CLOSED pSpeedET bacterial:kanamycin
27 HsCD00618172 Plasmid Details cDNA RPA3 replication protein A3, 14kDa NA BC005264 No/No CLOSED pLDNT7_nFLAG bacterial:chloramphenicol
28 HsCD00639755 Plasmid Details cDNA RAD51 RAD51 recombinase NA No/No FUSION pANT7_cGST bacterial:ampicillin
29 HsCD00664984 Plasmid Details cDNA RPA2 "replication protein A2, 32kDa" targeted domain No/No CLOSED pET15Nano6HT_NESG bacterial:ampicillin
30 HsUT00698400 Plasmid Details 3'UTR EPHA6 EPH receptor A6 Sequence Verified: Yes; 3'UTR length: 427; Forward Primer: CTAACACTTAACCTCTGCTATTCTGCATAA; Reverse Primer: CTTTTTTCTCGCTGCAAACTTTTTACACCA NM_173655 No/No NA P2RP3 bacterial:kanamycin
31 HsCD00731843 Plasmid Details cDNA RAD51 RAD51 recombinase NA D14134 No/No FUSION pANT7_cGST bacterial:ampicillin
32 HsCD00735090 Plasmid Details cDNA RAD52 RAD52 homolog, DNA repair protein NA U12134 No/No FUSION pANT7_cGST bacterial:ampicillin
33 HsCD00745352 Plasmid Details cDNA RPA3 replication protein A3, 14kDa NA BC005264.1 No/No FUSION pDONR221 bacterial:kanamycin
34 HsCD00785116 Plasmid Details cDNA RAD51 RAD51 recombinase NA NM_133487 Yes/No FUSION pANT7_cGST bacterial:ampicillin
35 HsCD00813162 Plasmid Details cDNA RAD51 RAD51 recombinase Gene synthesis by Gen9. Codon optimized NM_133487 No/No FUSION pDONR221 bacterial:kanamycin
No of Result Per Page : Page: