DNASU Plasmid Repository • 480.965.5697 | Email

Pathways Results


Pathway : Purine catabolism, 49 clones found

No of Result Per Page : Page: Explanation of Terms
Plasmid ID
Keywords Reference
Vector Selection
1 HsCD00041488 Plasmid Details cDNA NT5C2 5'-nucleotidase, cytosolic II NA BC001595 No/No FUSION pDONR221 bacterial:kanamycin
2 HsCD00044589 Plasmid Details cDNA NT5C2 5'-nucleotidase, cytosolic II NA BC001595 No/No CLOSED pDONR221 bacterial:kanamycin
3 HsCD00083722 Plasmid Details cDNA NT5C2 5'-nucleotidase, cytosolic II NA BC001595 No/No CLOSED pVP16 bacterial:ampicillin
4 HsCD00288206 Plasmid Details cDNA GPX1 glutathione peroxidase 1 NA BC007865.2 No/No FUSION pENTR223 bacterial:spectinomycin
5 HsCD00288512 Plasmid Details cDNA NT5C 5', 3'-nucleotidase, cytosolic NA BC017454.1 No/No FUSION pENTR223 bacterial:spectinomycin
6 HsCD00288674 Plasmid Details cDNA GDA guanine deaminase NA BC053584.1 No/No FUSION pENTR223 bacterial:spectinomycin
7 HsCD00294961 Plasmid Details cDNA XDH xanthine dehydrogenase NA NM_000379.3 No/No CLOSED pENTR223.1 bacterial:spectinomycin
8 HsCD00303181 Plasmid Details cDNA NT5C 5', 3'-nucleotidase, cytosolic NA BC017454.1 No/No FUSION pANT7_cGST bacterial:ampicillin
9 HsCD00303295 Plasmid Details cDNA GDA guanine deaminase NA BC053584.1 No/No FUSION pANT7_cGST bacterial:ampicillin
10 HsCD00352253 Plasmid Details cDNA NT5C 5', 3'-nucleotidase, cytosolic NA HQ448006 No/No FUSION pDONR223 bacterial:spectinomycin
11 HsCD00352410 Plasmid Details cDNA GDA guanine deaminase NA HQ448102 No/No FUSION pDONR223 bacterial:spectinomycin
12 HsCD00356149 Plasmid Details cDNA NT5C 5', 3'-nucleotidase, cytosolic NA HQ448006 No/No FUSION pANT7_cGST bacterial:ampicillin
13 HsCD00356293 Plasmid Details cDNA GDA guanine deaminase NA HQ448102 No/No FUSION pANT7_cGST bacterial:ampicillin
14 HsCD00397034 Plasmid Details cDNA GDA guanine deaminase full-length cds NM_004293 No/No CLOSED pVP33K bacterial:kanamycin
15 HsCD00398454 Plasmid Details cDNA CAT catalase NA HQ258304 No/No FUSION pDONR223 bacterial:spectinomycin
16 HsCD00403999 Plasmid Details cDNA CAT catalase NA HQ258304 No/No FUSION pANT7_cGST bacterial:ampicillin
17 HsCD00433170 Plasmid Details cDNA NT5E 5'-nucleotidase, ecto (CD73) full-length cds 28-552 of 574 aa No/Yes CLOSED pSGX3 bacterial:kanamycin
18 HsCD00436159 Plasmid Details cDNA GPX1 glutathione peroxidase 1 NA No/Yes FUSION pLX304 mammalian:blasticidin
19 HsCD00436751 Plasmid Details cDNA NT5C1A 5'-nucleotidase, cytosolic IA NA No/No FUSION pLX304 mammalian:blasticidin
20 HsCD00436807 Plasmid Details cDNA PNP purine nucleoside phosphorylase NA No/No FUSION pLX304 mammalian:blasticidin
21 HsCD00438946 Plasmid Details cDNA GDA guanine deaminase NA HQ448102 No/No FUSION pLX304 mammalian:blasticidin
22 HsCD00439092 Plasmid Details cDNA NT5C 5', 3'-nucleotidase, cytosolic NA HQ448006 No/No FUSION pLX304 mammalian:blasticidin
23 HsCD00439901 Plasmid Details cDNA NT5E 5'-nucleotidase, ecto (CD73) NA No/No FUSION pLX304 mammalian:blasticidin
24 HsCD00440767 Plasmid Details cDNA GPX1 glutathione peroxidase 1 NA No/No FUSION pLX304 mammalian:blasticidin
25 HsCD00441091 Plasmid Details cDNA NT5E 5'-nucleotidase, ecto (CD73) NA No/No FUSION pLX304 mammalian:blasticidin
26 HsCD00442265 Plasmid Details cDNA NT5C 5', 3'-nucleotidase, cytosolic NA HQ448006 No/No FUSION pLX304 mammalian:blasticidin
27 HsCD00443646 Plasmid Details cDNA NT5C1B 5'-nucleotidase, cytosolic IB NA No/Yes FUSION pLX304 mammalian:blasticidin
28 HsCD00445325 Plasmid Details cDNA NT5C 5', 3'-nucleotidase, cytosolic NA HQ448006 No/No FUSION pLX304 mammalian:blasticidin
29 HsCD00504928 Plasmid Details cDNA NT5C 5', 3'-nucleotidase, cytosolic NA HQ448006 No/No FUSION pENTR223 bacterial:spectinomycin
30 HsCD00506225 Plasmid Details cDNA GPX1 glutathione peroxidase 1 NA No/No FUSION pENTR223 bacterial:spectinomycin
31 HsCD00506870 Plasmid Details cDNA NT5C 5', 3'-nucleotidase, cytosolic NA HQ448006 No/No FUSION pENTR223 bacterial:spectinomycin
32 HsCD00507318 Plasmid Details cDNA NT5C 5', 3'-nucleotidase, cytosolic NA HQ448006 No/No FUSION pENTR223 bacterial:spectinomycin
33 HsCD00508557 Plasmid Details cDNA NT5E 5'-nucleotidase, ecto (CD73) NA No/No FUSION pENTR223 bacterial:spectinomycin
34 HsCD00509673 Plasmid Details cDNA PNP purine nucleoside phosphorylase NA No/No FUSION pENTR223 bacterial:spectinomycin
35 HsCD00510443 Plasmid Details cDNA NT5E 5'-nucleotidase, ecto (CD73) NA No/No FUSION pENTR223 bacterial:spectinomycin
36 HsCD00511622 Plasmid Details cDNA NT5C1A 5'-nucleotidase, cytosolic IA NA No/No FUSION pENTR223 bacterial:spectinomycin
37 HsCD00512843 Plasmid Details cDNA GDA guanine deaminase NA HQ448102 No/No FUSION pENTR223 bacterial:spectinomycin
38 HsCD00531844 Plasmid Details cDNA NT5E 5'-nucleotidase, ecto (CD73) full-length cds 28-552 of 574 aa No/Yes CLOSED pSGX3 bacterial:kanamycin
39 HsCD00546191 Plasmid Details cDNA NT5C2 5'-nucleotidase, cytosolic II NA BC001595 No/No CLOSED pSpeedET bacterial:kanamycin
40 HsCD00546367 Plasmid Details cDNA NT5C2 5'-nucleotidase, cytosolic II full-length cds BC001595 No/No CLOSED pDONR221 bacterial:kanamycin
41 HsCD00616403 Plasmid Details cDNA NT5C2 5'-nucleotidase, cytosolic II NA BC001595 No/No FUSION pANT7_cGST bacterial:ampicillin
42 HsCD00629529 Plasmid Details cDNA GPX1 glutathione peroxidase 1 NA No/No FUSION pANT7_cGST bacterial:ampicillin
43 HsCD00630693 Plasmid Details cDNA NT5E 5'-nucleotidase, ecto (CD73) NA No/No FUSION pANT7_cGST bacterial:ampicillin
44 HsCD00630999 Plasmid Details cDNA NT5C1A 5'-nucleotidase, cytosolic IA NA No/No FUSION pANT7_cGST bacterial:ampicillin
45 HsCD00642165 Plasmid Details cDNA PNP purine nucleoside phosphorylase NA NM_000270 No/No FUSION pANT7_cGST bacterial:ampicillin
46 HsUT00699281 Plasmid Details 3'UTR KLF2 Kruppel-like factor 2 Sequence Verified: Yes; 3'UTR length: 677; Forward Primer: CACATGAAACGGCACATGTAG; Reverse Primer: GCAGCTGGCAGTCCCGGT NM_016270 No/No NA P2RP3 bacterial:kanamycin
47 HsCD00719249 Plasmid Details cDNA GPX1 glutathione peroxidase 1 NA BC070258 No/No FUSION pDONR221 bacterial:kanamycin
48 HsCD00719323 Plasmid Details cDNA GPX1 glutathione peroxidase 1 NA BC070258 No/No FUSION pDONR221 bacterial:kanamycin
49 HsCD00732090 Plasmid Details cDNA GPX1 glutathione peroxidase 1 NA BC007865 No/No FUSION pANT7_cGST bacterial:ampicillin
No of Result Per Page : Page: