DNASU Plasmid Repository • 480.965.5697 | Email

Pathways Results

TOP

Pathway : Reduction of cytosolic Ca++ levels, 19 clones found

No of Result Per Page : Page: Explanation of Terms
  DNASU
Plasmid ID
Clone
Type
Gene
Symbol
Gene
Name
Keywords Reference
Sequence
Mutation/
Discrepancy
Insert
Format
Vector Selection
Markers
 
1 HsCD00045334 Plasmid Details cDNA ATP2A3 ATPase, Ca++ transporting, ubiquitous NA BC035729 No/No CLOSED pDONR221 bacterial:kanamycin
2 HsCD00076313 Plasmid Details cDNA ATP2A3 ATPase, Ca++ transporting, ubiquitous NA BC035729 No/No FUSION pDONR221 bacterial:kanamycin
3 HsCD00082487 Plasmid Details cDNA ATP2B4 ATPase, Ca++ transporting, plasma membrane 4 NA BX537444 No/Yes FUSION pDONR201 bacterial:kanamycin
4 HsCD00082492 Plasmid Details cDNA ATP2B4 ATPase, Ca++ transporting, plasma membrane 4 NA BX537444 No/Yes FUSION pDONR201 bacterial:kanamycin
5 HsCD00083023 Plasmid Details cDNA ATP2A1 ATPase, Ca++ transporting, cardiac muscle, fast twitch 1 NA NM_173201 No/No FUSION pENTR223.1 bacterial:spectinomycin
6 HsCD00295135 Plasmid Details cDNA SLC8A2 solute carrier family 8 (sodium/calcium exchanger), member 2 NA NM_015063.1 No/No CLOSED pENTR223.1 bacterial:spectinomycin
7 HsCD00295177 Plasmid Details cDNA SLC8A3 solute carrier family 8 (sodium/calcium exchanger), member 3 NA NM_183002.1 No/No CLOSED pENTR223.1 bacterial:spectinomycin
8 HsCD00351293 Plasmid Details cDNA SLC8A3 solute carrier family 8 (sodium/calcium exchanger), member 3 NA BC160014 No/No CLOSED pENTR223.1 bacterial:spectinomycin
9 HsCD00351391 Plasmid Details cDNA ATP2A1 ATPase, Ca++ transporting, cardiac muscle, fast twitch 1 NA BC148653 No/No FUSION pENTR223.1 bacterial:spectinomycin
10 HsCD00356549 Plasmid Details cDNA ATP2A1 ATPase, Ca++ transporting, cardiac muscle, fast twitch 1 NA BC148653 No/No FUSION pANT7_cGST bacterial:ampicillin
11 HsCD00437019 Plasmid Details cDNA ATP2B3 ATPase, Ca++ transporting, plasma membrane 3 NA No/Yes FUSION pLX304 mammalian:blasticidin
12 HsCD00437056 Plasmid Details cDNA ATP2B2 ATPase, Ca++ transporting, plasma membrane 2 NA No/No FUSION pLX304 mammalian:blasticidin
13 HsCD00440352 Plasmid Details cDNA SLC8A3 solute carrier family 8 (sodium/calcium exchanger), member 3 NA BC160014 No/Yes FUSION pLX304 mammalian:blasticidin
14 HsCD00505411 Plasmid Details cDNA ATP2B2 ATPase, Ca++ transporting, plasma membrane 2 NA No/No FUSION pENTR223 bacterial:spectinomycin
15 HsCD00508839 Plasmid Details cDNA SLC8A3 solute carrier family 8 (sodium/calcium exchanger), member 3 NA BC160014 No/Yes FUSION pENTR223 bacterial:spectinomycin
16 HsCD00631244 Plasmid Details cDNA SLC8A3 solute carrier family 8 (sodium/calcium exchanger), member 3 NA No/No FUSION pANT7_cGST bacterial:ampicillin
17 HsUT00698086 Plasmid Details 3'UTR SATB1 SATB homeobox 1 Sequence Verified: Yes; 3'UTR length: 1709; Forward Primer: ACAGACATTAATACTGATTTGAAAGACTGA; Reverse Primer: TGAAAAAAAAAAGCTAAGGGGTTTTTATAC NM_001131010 No/No NA P2RP3 bacterial:kanamycin
18 HsCD00731696 Plasmid Details cDNA ATP2A1 ATPase, Ca++ transporting, cardiac muscle, fast twitch 1 NA NM_173201 No/No FUSION pANT7_cGST bacterial:ampicillin
19 HsCD00732464 Plasmid Details cDNA ATP2A1 ATPase, Ca++ transporting, cardiac muscle, fast twitch 1 NA BC035729 No/No FUSION pANT7_cGST bacterial:ampicillin
No of Result Per Page : Page: