DNASU Plasmid Repository • 480.965.5697 | Email

Pathways Results


Pathway : Androgen/estrogene/progesterone biosynthesis, 51 clones found

No of Result Per Page : Page: Explanation of Terms
Plasmid ID
Keywords Reference
Vector Selection
1 HsCD00001130 Plasmid Details cDNA HSD17B2 hydroxysteroid (17-beta) dehydrogenase 2 NA NM_002153 No/Yes FUSION pDNR-Dual bacterial:ampicillin
2 HsCD00004327 Plasmid Details cDNA HSD17B7 hydroxysteroid (17-beta) dehydrogenase 7 NA BC007068 No/No FUSION pDNR-Dual bacterial:ampicillin
3 HsCD00004328 Plasmid Details cDNA HSD17B7 hydroxysteroid (17-beta) dehydrogenase 7 NA BC007068 No/No CLOSED pDNR-Dual bacterial:ampicillin
4 HsCD00004329 Plasmid Details cDNA HSD17B7 hydroxysteroid (17-beta) dehydrogenase 7 NA BC007068 No/No CLOSED pDNR-Dual bacterial:ampicillin
5 HsCD00040765 Plasmid Details cDNA SOAT1 sterol O-acyltransferase (acyl-Coenzyme A: cholesterol acyltransferase) 1 NA BC028940 No/No FUSION pDONR221 bacterial:kanamycin
6 HsCD00042084 Plasmid Details cDNA HSD17B2 hydroxysteroid (17-beta) dehydrogenase 2 NA BC009581 No/No FUSION pDONR221 bacterial:kanamycin
7 HsCD00043890 Plasmid Details cDNA SOAT1 sterol O-acyltransferase (acyl-Coenzyme A: cholesterol acyltransferase) 1 NA BC028940 No/Yes CLOSED pDONR221 bacterial:kanamycin
8 HsCD00045135 Plasmid Details cDNA HSD17B2 hydroxysteroid (17-beta) dehydrogenase 2 NA BC009581 No/No CLOSED pDONR221 bacterial:kanamycin
9 HsCD00076952 Plasmid Details cDNA SOAT1 sterol O-acyltransferase (acyl-Coenzyme A: cholesterol acyltransferase) 1 NA BC028940 No/No FUSION pANT7_cGST bacterial:ampicillin
10 HsCD00081873 Plasmid Details cDNA CYP19A1 cytochrome P450, family 19, subfamily A, polypeptide 1 NA BC035959 No/Yes FUSION pDONR221 bacterial:kanamycin
11 HsCD00082378 Plasmid Details cDNA CYP19A1 cytochrome P450, family 19, subfamily A, polypeptide 1 NA BC035959 No/Yes FUSION pDONR201 bacterial:kanamycin
12 HsCD00287787 Plasmid Details cDNA LIPA lipase A, lysosomal acid, cholesterol esterase (Wolman disease) NA BC012287.1 No/No FUSION pENTR223 bacterial:spectinomycin
13 HsCD00288166 Plasmid Details cDNA HSD17B6 hydroxysteroid (17-beta) dehydrogenase 6 homolog (mouse) NA BC020710.1 No/No FUSION pENTR223 bacterial:spectinomycin
14 HsCD00302303 Plasmid Details cDNA LIPA lipase A, lysosomal acid, cholesterol esterase (Wolman disease) NA BC012287.1 No/No FUSION pANT7_cGST bacterial:ampicillin
15 HsCD00326079 Plasmid Details cDNA HSD17B6 HGNC: 23316| MIM: 606623| Ensembl: ENSG00000025423| HPRD: 09431 SP or TM removed No/No FUSION pSpeedET bacterial:kanamycin
16 HsCD00351790 Plasmid Details cDNA HSD17B7 hydroxysteroid (17-beta) dehydrogenase 7 NA GQ129367 No/No CLOSED pENTR221 bacterial:kanamycin
17 HsCD00351869 Plasmid Details cDNA HSD17B7 hydroxysteroid (17-beta) dehydrogenase 7 NA GQ129366 No/No FUSION pENTR221 bacterial:kanamycin
18 HsCD00352695 Plasmid Details cDNA HSD17B6 hydroxysteroid (17-beta) dehydrogenase 6 homolog (mouse) NA HQ447624 No/No FUSION pDONR223 bacterial:spectinomycin
19 HsCD00353459 Plasmid Details cDNA LIPA lipase A, lysosomal acid, cholesterol esterase NA HQ447241 No/No FUSION pDONR223 bacterial:spectinomycin
20 HsCD00357213 Plasmid Details cDNA LIPA lipase A, lysosomal acid, cholesterol esterase NA HQ447241 No/No FUSION pANT7_cGST bacterial:ampicillin
21 HsCD00357820 Plasmid Details cDNA HSD17B7 hydroxysteroid (17-beta) dehydrogenase 7 NA GQ129366 No/No FUSION pANT7_cGST bacterial:ampicillin
22 HsCD00357870 Plasmid Details cDNA HSD17B6 hydroxysteroid (17-beta) dehydrogenase 6 homolog (mouse) NA HQ447624 No/No FUSION pANT7_cGST bacterial:ampicillin
23 HsCD00434473 Plasmid Details cDNA CYP19A1 cytochrome P450, family 19, subfamily A, polypeptide 1 NA AM393184 No/No FUSION pLX304 mammalian:blasticidin
24 HsCD00434977 Plasmid Details cDNA HSD17B2 hydroxysteroid (17-beta) dehydrogenase 2 NA DQ896372 No/No FUSION pLX304 mammalian:blasticidin
25 HsCD00435386 Plasmid Details cDNA SOAT1 sterol O-acyltransferase 1 NA DQ894991 No/No FUSION pLX304 mammalian:blasticidin
26 HsCD00436038 Plasmid Details cDNA HSD17B7 hydroxysteroid (17-beta) dehydrogenase 7 NA GQ129367 No/No FUSION pLX304 mammalian:blasticidin
27 HsCD00439073 Plasmid Details cDNA CYP19A1 cytochrome P450, family 19, subfamily A, polypeptide 1 NA AM393184 No/No FUSION pLX304 mammalian:blasticidin
28 HsCD00439220 Plasmid Details cDNA HSD17B6 hydroxysteroid (17-beta) dehydrogenase 6 homolog (mouse) NA HQ447624 No/No FUSION pLX304 mammalian:blasticidin
29 HsCD00441464 Plasmid Details cDNA HSD17B7 hydroxysteroid (17-beta) dehydrogenase 7 NA GQ129367 No/No FUSION pLX304 mammalian:blasticidin
30 HsCD00442856 Plasmid Details cDNA CYP19A1 cytochrome P450, family 19, subfamily A, polypeptide 1 NA AM393184 No/No FUSION pLX304 mammalian:blasticidin
31 HsCD00444279 Plasmid Details cDNA LIPA lipase A, lysosomal acid, cholesterol esterase NA HQ447241 No/No FUSION pLX304 mammalian:blasticidin
32 HsCD00506657 Plasmid Details cDNA CYP19A1 cytochrome P450, family 19, subfamily A, polypeptide 1 NA AM393184 No/No FUSION pENTR223 bacterial:spectinomycin
33 HsCD00507011 Plasmid Details cDNA CYP19A1 cytochrome P450, family 19, subfamily A, polypeptide 1 NA AM393184 No/No FUSION pENTR223 bacterial:spectinomycin
34 HsCD00509798 Plasmid Details cDNA HSD17B6 hydroxysteroid (17-beta) dehydrogenase 6 homolog (mouse) NA HQ447624 No/No FUSION pENTR223 bacterial:spectinomycin
35 HsCD00510152 Plasmid Details cDNA HSD17B7 hydroxysteroid (17-beta) dehydrogenase 7 NA GQ129367 No/No FUSION pENTR223 bacterial:spectinomycin
36 HsCD00510582 Plasmid Details cDNA HSD17B7 hydroxysteroid (17-beta) dehydrogenase 7 NA GQ129367 No/No FUSION pENTR223 bacterial:spectinomycin
37 HsCD00511041 Plasmid Details cDNA HSD17B2 hydroxysteroid (17-beta) dehydrogenase 2 NA DQ896372 No/No FUSION pENTR223 bacterial:spectinomycin
38 HsCD00511201 Plasmid Details cDNA LIPA lipase A, lysosomal acid, cholesterol esterase NA HQ447241 No/No FUSION pENTR223 bacterial:spectinomycin
39 HsCD00512497 Plasmid Details cDNA CYP19A1 cytochrome P450, family 19, subfamily A, polypeptide 1 NA AM393184 No/No FUSION pENTR223 bacterial:spectinomycin
40 HsCD00513304 Plasmid Details cDNA SOAT1 sterol O-acyltransferase 1 NA DQ894991 No/No FUSION pENTR223 bacterial:spectinomycin
41 HsCD00515348 Plasmid Details cDNA HSD17B1 hydroxysteroid (17-beta) dehydrogenase 1 NA No/No FUSION pENTR223 bacterial:spectinomycin
42 HsCD00617813 Plasmid Details cDNA HSD17B7 hydroxysteroid (17-beta) dehydrogenase 7 NA BC007068 No/No CLOSED pLDNT7_nFLAG bacterial:chloramphenicol
43 HsCD00640403 Plasmid Details cDNA HSD17B1 hydroxysteroid (17-beta) dehydrogenase 1 NA NM_000413 No/No FUSION pANT7_cGST bacterial:ampicillin
44 HsCD00673938 Plasmid Details cDNA SOAT2 sterol O-acyltransferase 2 NA BC099626 No/No FUSION pANT7_cGST bacterial:ampicillin
45 HsUT00699337 Plasmid Details 3'UTR ZNF619 zinc finger protein 619 Sequence Verified: Yes; 3'UTR length: 2176; Forward Primer: AATCCTTTGTCTCACTCCCTGTAA; Reverse Primer: TTCCAGATTTTTCAAGCCTCTACCCATTAC NM_001145093 No/No NA P2RP3 bacterial:kanamycin
46 HsCD00718534 Plasmid Details cDNA SOAT2 sterol O-acyltransferase 2 NA BC099626 No/No FUSION pDONR221 bacterial:kanamycin
47 HsCD00731871 Plasmid Details cDNA CYP19A1 cytochrome P450, family 19, subfamily A, polypeptide 1 NA BC035959 No/No FUSION pANT7_cGST bacterial:ampicillin
48 HsCD00732480 Plasmid Details cDNA HSD17B2 hydroxysteroid (17-beta) dehydrogenase 2 NA BC009581 No/No FUSION pANT7_cGST bacterial:ampicillin
49 HsCD00733619 Plasmid Details cDNA HSD17B6 hydroxysteroid (17-beta) dehydrogenase 6 NA BC020710 No/No FUSION pANT7_cGST bacterial:ampicillin
50 HsCD00745020 Plasmid Details cDNA HSD17B7 hydroxysteroid (17-beta) dehydrogenase 7 NA BC007068.1 No/No FUSION pDONR221 bacterial:kanamycin
No of Result Per Page : Page: