DNASU Plasmid Repository • 480.965.5697 | Email

Pathways Results

TOP

Pathway : Vitamin D metabolism and pathway, 41 clones found

No of Result Per Page : Page: Explanation of Terms
  DNASU
Plasmid ID
Clone
Type
Gene
Symbol
Gene
Name
Keywords Reference
Sequence
Mutation/
Discrepancy
Insert
Format
Vector Selection
Markers
 
1 HsCD00002073 Plasmid Details cDNA FDX1 ferredoxin 1 NA BC017063 No/No FUSION pDNR-Dual bacterial:ampicillin
2 HsCD00002074 Plasmid Details cDNA FDX1 ferredoxin 1 NA BC017063 No/No FUSION pDNR-Dual bacterial:ampicillin
3 HsCD00002075 Plasmid Details cDNA FDX1 ferredoxin 1 NA BC017063 No/No CLOSED pDNR-Dual bacterial:ampicillin
4 HsCD00002076 Plasmid Details cDNA FDX1 ferredoxin 1 NA BC017063 No/No CLOSED pDNR-Dual bacterial:ampicillin
5 HsCD00074552 Plasmid Details cDNA FDX1 ferredoxin 1 NA BC017063 No/No CLOSED pJP1520 mammalian:puromycin
6 HsCD00074553 Plasmid Details cDNA FDX1 ferredoxin 1 NA BC017063 No/No CLOSED pJP1520 mammalian:puromycin
7 HsCD00079585 Plasmid Details cDNA VDR vitamin D (1,25- dihydroxyvitamin D3) receptor NA BC060832 No/No FUSION pDONR221 bacterial:kanamycin
8 HsCD00079702 Plasmid Details cDNA RXRA retinoid X receptor, alpha NA BC110998 No/No FUSION pDONR221 bacterial:kanamycin
9 HsCD00295902 Plasmid Details cDNA VDR vitamin D (1,25- dihydroxyvitamin D3) receptor NA BC060832.1 No/No CLOSED pDONR221 bacterial:kanamycin
10 HsCD00296160 Plasmid Details cDNA VDR vitamin D (1,25- dihydroxyvitamin D3) receptor NA BC060832.1 No/No FUSION pDONR221 bacterial:kanamycin
11 HsCD00330044 Plasmid Details cDNA RXRA retinoid X receptor, alpha NA BC110998 No/No FUSION pLenti6.2/V5-DEST mammalian:blasticidin
12 HsCD00330410 Plasmid Details cDNA VDR vitamin D (1,25- dihydroxyvitamin D3) receptor NA BC060832 No/No FUSION pLenti6.2/V5-DEST mammalian:blasticidin
13 HsCD00435952 Plasmid Details cDNA CYP27A1 cytochrome P450, family 27, subfamily A, polypeptide 1 NA No/No FUSION pLX304 mammalian:blasticidin
14 HsCD00436700 Plasmid Details cDNA CYP24A1 cytochrome P450, family 24, subfamily A, polypeptide 1 NA No/No FUSION pLX304 mammalian:blasticidin
15 HsCD00437134 Plasmid Details cDNA RXRA retinoid X receptor, alpha NA EU446653 No/Yes FUSION pLX304 mammalian:blasticidin
16 HsCD00439386 Plasmid Details cDNA GC group-specific component (vitamin D binding protein) NA No/No FUSION pLX304 mammalian:blasticidin
17 HsCD00442558 Plasmid Details cDNA VDR vitamin D (1,25- dihydroxyvitamin D3) receptor NA EU831857 No/No FUSION pLX304 mammalian:blasticidin
18 HsCD00442953 Plasmid Details cDNA CYP27B1 cytochrome P450, family 27, subfamily B, polypeptide 1 NA No/No FUSION pLX304 mammalian:blasticidin
19 HsCD00506364 Plasmid Details cDNA RXRA retinoid X receptor, alpha NA EU446653 No/Yes FUSION pENTR223 bacterial:spectinomycin
20 HsCD00512048 Plasmid Details cDNA CYP24A1 cytochrome P450, family 24, subfamily A, polypeptide 1 NA No/No FUSION pENTR223 bacterial:spectinomycin
21 HsCD00512292 Plasmid Details cDNA GC group-specific component (vitamin D binding protein) NA No/No FUSION pENTR223 bacterial:spectinomycin
22 HsCD00512811 Plasmid Details cDNA VDR vitamin D (1,25- dihydroxyvitamin D3) receptor NA EU831857 No/No FUSION pENTR223 bacterial:spectinomycin
23 HsCD00513843 Plasmid Details cDNA CYP27B1 cytochrome P450, family 27, subfamily B, polypeptide 1 NA No/No FUSION pENTR223 bacterial:spectinomycin
24 HsCD00513866 Plasmid Details cDNA CYP27A1 cytochrome P450, family 27, subfamily A, polypeptide 1 NA No/No FUSION pENTR223 bacterial:spectinomycin
25 HsCD00514897 Plasmid Details cDNA FDX1 ferredoxin 1 NA No/No FUSION pENTR223 bacterial:spectinomycin
26 HsCD00515566 Plasmid Details cDNA CYP27C1 cytochrome P450, family 27, subfamily C, polypeptide 1 NA No/No FUSION pENTR223 bacterial:spectinomycin
27 HsCD00618335 Plasmid Details cDNA FDX1 ferredoxin 1 NA BC017063 No/No CLOSED pLDNT7_nFLAG bacterial:chloramphenicol
28 HsCD00629309 Plasmid Details cDNA CYP24A1 cytochrome P450, family 24, subfamily A, polypeptide 1 NA No/No FUSION pANT7_cGST bacterial:ampicillin
29 HsCD00630745 Plasmid Details cDNA GC group-specific component (vitamin D binding protein) NA No/No FUSION pANT7_cGST bacterial:ampicillin
30 HsCD00630816 Plasmid Details cDNA CYP27C1 cytochrome P450, family 27, subfamily C, polypeptide 1 NA No/No FUSION pANT7_cGST bacterial:ampicillin
31 HsCD00639470 Plasmid Details cDNA FDX1 ferredoxin 1 NA No/No FUSION pANT7_cGST bacterial:ampicillin
32 HsCD00639502 Plasmid Details cDNA CYP27B1 cytochrome P450, family 27, subfamily B, polypeptide 1 NA No/No FUSION pANT7_cGST bacterial:ampicillin
33 HsCD00640060 Plasmid Details cDNA CYP27A1 cytochrome P450, family 27, subfamily A, polypeptide 1 NA NM_000784 No/No FUSION pANT7_cGST bacterial:ampicillin
34 HsCD00651870 Plasmid Details cDNA RXRA retinoid X receptor, alpha targeted domain No/No FUSION pET15Avi6HT_NESG bacterial:ampicillin
35 HsCD00651882 Plasmid Details cDNA VDR vitamin D (1,25- dihydroxyvitamin D3) receptor targeted domain No/No FUSION pET15Avi6HT_NESG bacterial:ampicillin
36 HsCD00663620 Plasmid Details cDNA VDR "vitamin D (1,25- dihydroxyvitamin D3) receptor" targeted domain No/Yes CLOSED pET15Nano6HT_NESG bacterial:ampicillin
37 HsUT00699223 Plasmid Details 3'UTR YTHDF2 YTH N(6)-methyladenosine RNA binding protein 2 Sequence Verified: Yes; 3'UTR length: 1003; Forward Primer: GAACGTCAAGGTCGTGGGAAATAA; Reverse Primer: GTTAACCAGCCCTGGGTACAAAG NM_001172828 No/No NA P2RP3 bacterial:kanamycin
38 HsCD00731526 Plasmid Details cDNA VDR vitamin D (1,25- dihydroxyvitamin D3) receptor NA BC060832 No/No FUSION pANT7_cGST bacterial:ampicillin
39 HsCD00731591 Plasmid Details cDNA RXRA retinoid X receptor, alpha NA BC110998 No/No FUSION pANT7_cGST bacterial:ampicillin
40 HsCD00817621 Plasmid Details cDNA VDR "vitamin D (1,25- dihydroxyvitamin D3) receptor" "insert_ID 54457,DNASU_Clone_ID HsCD00079585" BC060832 No/No FUSION pJFT7_nHalo_DC(r4) bacterial:ampicillin
41 HsCD00817678 Plasmid Details cDNA RXRA retinoid X receptor alpha "insert_ID 54574,DNASU_Clone_ID HsCD00079702" BC110998 No/No FUSION pJFT7_nHalo_DC(r4) bacterial:ampicillin
No of Result Per Page : Page: