DNASU Plasmid Repository • 480.965.5697 | Email

Pathways Results

TOP

Pathway : Beta-oxidation of very long chain fatty acids, 42 clones found

No of Result Per Page : Page: Explanation of Terms
  DNASU
Plasmid ID
Clone
Type
Gene
Symbol
Gene
Name
Keywords Reference
Sequence
Mutation/
Discrepancy
Insert
Format
Vector Selection
Markers
 
1 HsCD00005310 Plasmid Details cDNA PTE1 peroxisomal acyl-CoA thioesterase NA NM_005469 No/Yes FUSION pDONR201 bacterial:kanamycin
2 HsCD00022297 Plasmid Details cDNA ACOT8 acyl-CoA thioesterase 8 NA X86032 No/Yes CLOSED pDONR201 bacterial:kanamycin
3 HsCD00022469 Plasmid Details cDNA CRAT carnitine acetyltransferase potential short variant BC000723 No/No FUSION pDNR-Dual bacterial:ampicillin
4 HsCD00022470 Plasmid Details cDNA CRAT carnitine acetyltransferase potential short variant BC000723 No/No CLOSED pDNR-Dual bacterial:ampicillin
5 HsCD00039863 Plasmid Details cDNA ABCD1 ATP-binding cassette, sub-family D (ALD), member 1 NA BC015541 No/No FUSION pDONR221 bacterial:kanamycin
6 HsCD00040168 Plasmid Details cDNA ACAA1 acetyl-Coenzyme A acyltransferase 1 (peroxisomal 3-oxoacyl-Coenzyme A thiolase) NA BC011977 No/No FUSION pDONR221 bacterial:kanamycin
7 HsCD00040817 Plasmid Details cDNA HSD17B4 hydroxysteroid (17-beta) dehydrogenase 4 NA BC003098 No/No FUSION pDONR221 bacterial:kanamycin
8 HsCD00043017 Plasmid Details cDNA ABCD1 ATP-binding cassette, sub-family D (ALD), member 1 NA BC015541 No/Yes CLOSED pDONR221 bacterial:kanamycin
9 HsCD00043315 Plasmid Details cDNA ACAA1 acetyl-Coenzyme A acyltransferase 1 (peroxisomal 3-oxoacyl-Coenzyme A thiolase) NA BC011977 No/No CLOSED pDONR221 bacterial:kanamycin
10 HsCD00043939 Plasmid Details cDNA HSD17B4 hydroxysteroid (17-beta) dehydrogenase 4 NA BC003098 No/No CLOSED pDONR221 bacterial:kanamycin
11 HsCD00045363 Plasmid Details cDNA ACAA1 acetyl-Coenzyme A acyltransferase 1 (peroxisomal 3-oxoacyl-Coenzyme A thiolase) NA BC011977 No/No CLOSED pDONR221 bacterial:kanamycin
12 HsCD00082477 Plasmid Details cDNA ACOX1 acyl-Coenzyme A oxidase 1, palmitoyl NA NM_004035 No/Yes FUSION pDONR201 bacterial:kanamycin
13 HsCD00301560 Plasmid Details cDNA PTE1 peroxisomal acyl-CoA thioesterase NA NM_005469 No/Yes FUSION pANT7_cGST bacterial:ampicillin
14 HsCD00351518 Plasmid Details cDNA ACOX1 acyl-CoA oxidase 1, palmitoyl NA AM393156 No/No FUSION pENTR201 bacterial:kanamycin
15 HsCD00353627 Plasmid Details cDNA ACOT8 acyl-CoA thioesterase 8 NA HQ258192 No/No FUSION pDONR223 bacterial:spectinomycin
16 HsCD00402850 Plasmid Details cDNA ACOX1 acyl-CoA oxidase 1, palmitoyl NA AM393156 No/No FUSION pANT7_cGST bacterial:ampicillin
17 HsCD00403396 Plasmid Details cDNA ACOT8 acyl-CoA thioesterase 8 NA HQ258192 No/No FUSION pANT7_cGST bacterial:ampicillin
18 HsCD00433972 Plasmid Details cDNA ACAA1 acetyl-CoA acyltransferase 1 NA DQ894482 No/No FUSION pLX304 mammalian:blasticidin
19 HsCD00435415 Plasmid Details cDNA HSD17B4 hydroxysteroid (17-beta) dehydrogenase 4 NA DQ895055 No/No FUSION pLX304 mammalian:blasticidin
20 HsCD00436585 Plasmid Details cDNA ACOT8 acyl-CoA thioesterase 8 NA HQ258192 No/No FUSION pLX304 mammalian:blasticidin
21 HsCD00437534 Plasmid Details cDNA ACOX1 acyl-CoA oxidase 1, palmitoyl NA AM393156 No/No FUSION pLX304 mammalian:blasticidin
22 HsCD00440613 Plasmid Details cDNA CRAT carnitine O-acetyltransferase NA No/No FUSION pLX304 mammalian:blasticidin
23 HsCD00441612 Plasmid Details cDNA ACAA1 acetyl-CoA acyltransferase 1 NA DQ894482 No/No FUSION pLX304 mammalian:blasticidin
24 HsCD00505500 Plasmid Details cDNA HSD17B4 hydroxysteroid (17-beta) dehydrogenase 4 NA DQ895055 No/No FUSION pENTR223 bacterial:spectinomycin
25 HsCD00509281 Plasmid Details cDNA ACOT8 acyl-CoA thioesterase 8 NA HQ258192 No/No FUSION pENTR223 bacterial:spectinomycin
26 HsCD00509917 Plasmid Details cDNA ACAA1 acetyl-CoA acyltransferase 1 NA DQ894482 No/No FUSION pENTR223 bacterial:spectinomycin
27 HsCD00511854 Plasmid Details cDNA ACAA1 acetyl-CoA acyltransferase 1 NA DQ894482 No/No FUSION pENTR223 bacterial:spectinomycin
28 HsCD00513909 Plasmid Details cDNA CRAT carnitine O-acetyltransferase NA No/No FUSION pENTR223 bacterial:spectinomycin
29 HsCD00514336 Plasmid Details cDNA ACOX1 acyl-CoA oxidase 1, palmitoyl NA AM393156 No/No FUSION pENTR223 bacterial:spectinomycin
30 HsCD00584083 Plasmid Details cDNA ABCD1 ATP-binding cassette, sub-family D (ALD), member 1 targeted domain No/No CLOSED pET15_NESG bacterial:ampicillin
31 HsCD00584084 Plasmid Details cDNA ABCD1 ATP-binding cassette, sub-family D (ALD), member 1 targeted domain No/Yes CLOSED pET15_NESG bacterial:ampicillin
32 HsCD00584085 Plasmid Details cDNA ABCD1 ATP-binding cassette, sub-family D (ALD), member 1 targeted domain No/No CLOSED pET15_NESG bacterial:ampicillin
33 HsCD00584086 Plasmid Details cDNA ABCD1 ATP-binding cassette, sub-family D (ALD), member 1 targeted domain No/No CLOSED pET15_NESG bacterial:ampicillin
34 HsCD00584087 Plasmid Details cDNA ABCD1 ATP-binding cassette, sub-family D (ALD), member 1 targeted domain No/No CLOSED pET15_NESG bacterial:ampicillin
35 HsCD00584088 Plasmid Details cDNA ABCD1 ATP-binding cassette, sub-family D (ALD), member 1 targeted domain No/No CLOSED pET15_NESG bacterial:ampicillin
36 HsCD00626504 Plasmid Details cDNA HSD17B4 hydroxysteroid (17-beta) dehydrogenase 4 NA No/No CLOSED pET15_NESG bacterial:ampicillin
37 HsCD00629101 Plasmid Details cDNA CRAT carnitine O-acetyltransferase NA No/No FUSION pANT7_cGST bacterial:ampicillin
38 HsUT00699134 Plasmid Details 3'UTR EPHB2 EPH receptor B2 Sequence Verified: Yes; 3'UTR length: 1940; Forward Primer: CAGATTCAGTCTGTGGAGGTTTGA; Reverse Primer: GGAGCTGTCGTTCTCCATGTGTTTT NM_004442 No/No NA P2RP3 bacterial:kanamycin
39 HsCD00731324 Plasmid Details cDNA ACAA1 acetyl-CoA acyltransferase 1 NA BC011977 No/No FUSION pANT7_cGST bacterial:ampicillin
40 HsCD00731373 Plasmid Details cDNA ABCD1 ATP-binding cassette, sub-family D (ALD), member 1 NA BC015541 No/No FUSION pANT7_cGST bacterial:ampicillin
41 HsCD00732384 Plasmid Details cDNA HSD17B4 hydroxysteroid (17-beta) dehydrogenase 4 NA BC003098 No/No FUSION pANT7_cGST bacterial:ampicillin
42 HsCD00732518 Plasmid Details cDNA ACOX1 acyl-CoA oxidase 1, palmitoyl NA NM_004035 No/No FUSION pANT7_cGST bacterial:ampicillin
No of Result Per Page : Page: