DNASU Plasmid Repository • 480.965.5697 | Email

Pathways Results

TOP

Pathway : Binding and entry of HIV virion, 38 clones found

No of Result Per Page : Page: Explanation of Terms
  DNASU
Plasmid ID
Clone
Type
Gene
Symbol
Gene
Name
Keywords Reference
Sequence
Mutation/
Discrepancy
Insert
Format
Vector Selection
Markers
 
1 HsCD00001559 Plasmid Details cDNA CD4 CD4 antigen (p55) NA NM_000616 No/Yes CLOSED pDNR-Dual bacterial:ampicillin
2 HsCD00001560 Plasmid Details cDNA CD4 CD4 antigen (p55) NA NM_000616 No/Yes CLOSED pDNR-Dual bacterial:ampicillin
3 HsCD00002210 Plasmid Details cDNA CXCR4 chemokine (C-X-C motif) receptor 4 NA BC020968 No/No FUSION pDNR-Dual bacterial:ampicillin
4 HsCD00002211 Plasmid Details cDNA CXCR4 chemokine (C-X-C motif) receptor 4 NA BC020968 No/No CLOSED pDNR-Dual bacterial:ampicillin
5 HsCD00041008 Plasmid Details cDNA CD4 CD4 molecule NA BC025782 No/No FUSION pDONR221 bacterial:kanamycin
6 HsCD00041604 Plasmid Details cDNA PPIA peptidylprolyl isomerase A (cyclophilin A) NA BC000689 No/No FUSION pDONR221 bacterial:kanamycin
7 HsCD00044125 Plasmid Details cDNA CD4 CD4 molecule NA BC025782 No/No CLOSED pDONR221 bacterial:kanamycin
8 HsCD00044677 Plasmid Details cDNA PPIA peptidylprolyl isomerase A (cyclophilin A) NA BC000689 No/No CLOSED pDONR221 bacterial:kanamycin
9 HsCD00075038 Plasmid Details cDNA CD4 CD4 antigen (p55) NA NM_000616 No/Yes CLOSED pJP1520 mammalian:puromycin
10 HsCD00075846 Plasmid Details cDNA CD4 CD4 antigen (p55) NA NM_000616 No/Yes CLOSED pJP1520 mammalian:puromycin
11 HsCD00075847 Plasmid Details cDNA CD4 CD4 antigen (p55) NA NM_000616 No/Yes CLOSED pJP1520 mammalian:puromycin
12 HsCD00077984 Plasmid Details cDNA CD4 CD4 molecule NA BC025782 No/No FUSION pANT7_cGST bacterial:ampicillin
13 HsCD00292912 Plasmid Details cDNA CXCR4 chemokine (C-X-C motif) receptor 4 NA NP_003458 No/No CLOSED pET28a bacterial:kanamycin
14 HsCD00292917 Plasmid Details cDNA CXCR4 C-X-C chemokine receptor type 4 NA NP_003458 No/No CLOSED pET28a bacterial:kanamycin
15 HsCD00292922 Plasmid Details cDNA CXCR4 chemokine (C-X-C motif) receptor 4 NA NP_003458 No/No CLOSED pET28a bacterial:kanamycin
16 HsCD00292940 Plasmid Details cDNA CXCR4 chemokine (C-X-C motif) receptor 4 NA NP_003458 No/No CLOSED pJ2 bacterial:kanamycin
17 HsCD00292941 Plasmid Details cDNA CXCR4 chemokine (C-X-C motif) receptor 4 NA NP_003458 No/No CLOSED pJ2 bacterial:kanamycin
18 HsCD00295882 Plasmid Details cDNA CXCR4 chemokine (C-X-C motif) receptor 4 NA BC020968.2 No/No CLOSED pDONR221 bacterial:kanamycin
19 HsCD00296139 Plasmid Details cDNA CXCR4 chemokine (C-X-C motif) receptor 4 NA BC020968.2 No/No FUSION pDONR221 bacterial:kanamycin
20 HsCD00304900 Plasmid Details cDNA CXCR4 chemokine (C-X-C motif) receptor 4 NA NM_003467 Unknown/Unknown FUSION pDONR201 bacterial:kanamycin
21 HsCD00304961 Plasmid Details cDNA CCR5 chemokine (C-C motif) receptor 5 NA NM_000579 Unknown/Unknown FUSION pDONR201 bacterial:kanamycin
22 HsCD00305485 Plasmid Details cDNA CXCR4 chemokine (C-X-C motif) receptor 4 NA NM_003467 Unknown/Unknown FUSION pANT7_cGST bacterial:ampicillin
23 HsCD00399807 Plasmid Details cDNA CXCR4 chemokine (C-X-C motif) receptor 4 NA JF432649 No/No FUSION pDONR223 bacterial:spectinomycin
24 HsCD00404709 Plasmid Details cDNA CXCR4 chemokine (C-X-C motif) receptor 4 NA JF432649 No/No FUSION pANT7_cGST bacterial:ampicillin
25 HsCD00413449 Plasmid Details cDNA CD4 CD4 molecule NA BC025782 No/No FUSION pDONR221 bacterial:kanamycin
26 HsCD00413471 Plasmid Details cDNA CD4 CD4 molecule NA BC025782 No/No CLOSED pDONR221 bacterial:kanamycin
27 HsCD00434362 Plasmid Details cDNA PPIA peptidylprolyl isomerase A (cyclophilin A) NA DQ895865 No/No FUSION pLX304 mammalian:blasticidin
28 HsCD00438616 Plasmid Details cDNA CD4 CD4 molecule NA DQ895246 No/No FUSION pLX304 mammalian:blasticidin
29 HsCD00440961 Plasmid Details cDNA PPIA peptidylprolyl isomerase A (cyclophilin A) NA DQ895865 No/No FUSION pLX304 mammalian:blasticidin
30 HsCD00444855 Plasmid Details cDNA CXCR4 chemokine (C-X-C motif) receptor 4 NA EU831888 No/No FUSION pLX304 mammalian:blasticidin
31 HsCD00506343 Plasmid Details cDNA PPIA peptidylprolyl isomerase A (cyclophilin A) NA DQ895865 No/No FUSION pENTR223 bacterial:spectinomycin
32 HsCD00506397 Plasmid Details cDNA PPIA peptidylprolyl isomerase A (cyclophilin A) NA DQ895865 No/No FUSION pENTR223 bacterial:spectinomycin
33 HsCD00510266 Plasmid Details cDNA CXCR4 chemokine (C-X-C motif) receptor 4 NA EU831888 No/No FUSION pENTR223 bacterial:spectinomycin
34 HsCD00512134 Plasmid Details cDNA CD4 CD4 molecule NA DQ895246 No/No FUSION pENTR223 bacterial:spectinomycin
35 HsCD00670652 Plasmid Details cDNA CCR5 chemokine (C-C motif) receptor 5 (gene/pseudogene) "Rubredoxin fusion, C-C chemokine receptor type 5" NM_000579 No/No CLOSED pFASTBAC1 bacterial:ampicillin
36 HsUT00699294 Plasmid Details 3'UTR NHEJ1 nonhomologous end-joining factor 1 Sequence Verified: Yes; 3'UTR length: 1237; Forward Primer: AAGCCAAGGGGTCTCTTCAGTTAA; Reverse Primer: GACCTTTGATAAGTCACTTACTCACTTCAG NM_024782 No/No NA P2RP3 bacterial:kanamycin
37 HsCD00730944 Plasmid Details cDNA PPIA peptidylprolyl isomerase A (cyclophilin A) NA BC000689 No/No FUSION pANT7_cGST bacterial:ampicillin
38 HsCD00732342 Plasmid Details cDNA CCR5 chemokine (C-C motif) receptor 5 (gene/pseudogene) NA NM_000579 No/No FUSION pANT7_cGST bacterial:ampicillin
No of Result Per Page : Page: