DNASU Plasmid Repository • 480.965.5697 | Email

Pathways Results

TOP

Pathway : Bupropion degradation, 3 clones found

No of Result Per Page : Page: Explanation of Terms
  DNASU
Plasmid ID
Clone
Type
Gene
Symbol
Gene
Name
Keywords Reference
Sequence
Mutation/
Discrepancy
Insert
Format
Vector Selection
Markers
 
1 HsCD00515839 Plasmid Details cDNA CYP2B6 cytochrome P450, family 2, subfamily B, polypeptide 6 NA No/No FUSION pENTR223 bacterial:spectinomycin
2 HsCD00630973 Plasmid Details cDNA CYP2B6 cytochrome P450, family 2, subfamily B, polypeptide 6 NA No/No FUSION pANT7_cGST bacterial:ampicillin
3 HsUT00697950 Plasmid Details 3'UTR FGR FGR proto-oncogene, Src family tyrosine kinase Sequence Verified: Yes; 3'UTR length: 804; Forward Primer: CCCGGGGATCAGACATAG; Reverse Primer: CTCTGGGTGTTCTAAAACTCCACAC NM_001042747 No/No NA P2RP3 bacterial:kanamycin
No of Result Per Page : Page: