DNASU Plasmid Repository • 480.965.5697 | Email

Pathways Results

TOP

Pathway : CYP2E1 reactions, 41 clones found

No of Result Per Page : Page: Explanation of Terms
  DNASU
Plasmid ID
Clone
Type
Gene
Symbol
Gene
Name
Keywords Reference
Sequence
Mutation/
Discrepancy
Insert
Format
Vector Selection
Markers
 
1 HsCD00040265 Plasmid Details cDNA CYP2C8 cytochrome P450, family 2, subfamily C, polypeptide 8 NA BC020596 No/No FUSION pDONR221 bacterial:kanamycin
2 HsCD00040999 Plasmid Details cDNA CPA6 carboxypeptidase A6 NA BC033684 No/No FUSION pDONR221 bacterial:kanamycin
3 HsCD00042367 Plasmid Details cDNA CYP2S1 cytochrome P450, family 2, subfamily S, polypeptide 1 NA BC033691 No/No FUSION pDONR221 bacterial:kanamycin
4 HsCD00043417 Plasmid Details cDNA CYP2C8 cytochrome P450, family 2, subfamily C, polypeptide 8 NA BC020596 No/No CLOSED pDONR221 bacterial:kanamycin
5 HsCD00044116 Plasmid Details cDNA CPA6 carboxypeptidase A6 NA BC033684 No/No CLOSED pDONR221 bacterial:kanamycin
6 HsCD00045380 Plasmid Details cDNA CYP2S1 cytochrome P450, family 2, subfamily S, polypeptide 1 NA BC033691 No/No CLOSED pDONR221 bacterial:kanamycin
7 HsCD00073953 Plasmid Details cDNA CYP2D6 cytochrome P450, family 2, subfamily D, polypeptide 6 NA CR456430 No/No FUSION pENTR223 bacterial:spectinomycin
8 HsCD00074047 Plasmid Details cDNA CYP2D6 cytochrome P450, family 2, subfamily D, polypeptide 6 NA CR456430 No/No CLOSED pENTR223 bacterial:spectinomycin
9 HsCD00080226 Plasmid Details cDNA CYP2A13 cytochrome P450, family 2, subfamily A, polypeptide 13 NA NM_000766 No/No FUSION pENTR223.1 bacterial:spectinomycin
10 HsCD00082665 Plasmid Details cDNA CYP2C19 cytochrome P450, family 2, subfamily C, polypeptide 19 NA BC111846 No/No FUSION pENTR223.1 bacterial:spectinomycin
11 HsCD00082918 Plasmid Details cDNA CYP2A13 cytochrome P450, family 2, subfamily A, polypeptide 13 NA NM_000766 No/No CLOSED pENTR223.1 bacterial:spectinomycin
12 HsCD00350867 Plasmid Details cDNA CYP2D6 cytochrome P450, family 2, subfamily D, polypeptide 6 NA CU013213 No/No CLOSED pENTR223 bacterial:spectinomycin
13 HsCD00351251 Plasmid Details cDNA CYP2D6 cytochrome P450, family 2, subfamily D, polypeptide 6 NA CU013501 No/No FUSION pENTR223 bacterial:spectinomycin
14 HsCD00398451 Plasmid Details cDNA CYP2A7 cytochrome P450, family 2, subfamily A, polypeptide 7 NA HQ258268 No/No FUSION pDONR223 bacterial:spectinomycin
15 HsCD00402628 Plasmid Details cDNA CYP2D6 cytochrome P450, family 2, subfamily D, polypeptide 6 NA CU013501 No/No FUSION pANT7_cGST bacterial:ampicillin
16 HsCD00403997 Plasmid Details cDNA CYP2A7 cytochrome P450, family 2, subfamily A, polypeptide 7 NA HQ258268 No/No FUSION pANT7_cGST bacterial:ampicillin
17 HsCD00435284 Plasmid Details cDNA CYP2S1 cytochrome P450, family 2, subfamily S, polypeptide 1 NA DQ896681 No/No FUSION pLX304 mammalian:blasticidin
18 HsCD00436784 Plasmid Details cDNA CYP2F1 cytochrome P450, family 2, subfamily F, polypeptide 1 NA No/Yes FUSION pLX304 mammalian:blasticidin
19 HsCD00439054 Plasmid Details cDNA CYP2C9 cytochrome P450, family 2, subfamily C, polypeptide 9 NA No/No FUSION pLX304 mammalian:blasticidin
20 HsCD00443471 Plasmid Details cDNA CYP2C9 cytochrome P450, family 2, subfamily C, polypeptide 9 NA No/No FUSION pLX304 mammalian:blasticidin
21 HsCD00443474 Plasmid Details cDNA CYP2A6 cytochrome P450, family 2, subfamily A, polypeptide 6 NA HQ258268 No/No FUSION pLX304 mammalian:blasticidin
22 HsCD00446258 Plasmid Details cDNA CYP2E1 cytochrome P450, family 2, subfamily E, polypeptide 1 NA No/No FUSION pLX304 mammalian:blasticidin
23 HsCD00446690 Plasmid Details cDNA CYP2A7 cytochrome P450, family 2, subfamily A, polypeptide 7 NA No/No FUSION pLX304 mammalian:blasticidin
24 HsCD00506370 Plasmid Details cDNA CYP2C9 cytochrome P450, family 2, subfamily C, polypeptide 9 NA No/No FUSION pENTR223 bacterial:spectinomycin
25 HsCD00512405 Plasmid Details cDNA CYP2C9 cytochrome P450, family 2, subfamily C, polypeptide 9 NA No/No FUSION pENTR223 bacterial:spectinomycin
26 HsCD00512408 Plasmid Details cDNA CYP2A6 cytochrome P450, family 2, subfamily A, polypeptide 6 NA HQ258268 No/No FUSION pENTR223 bacterial:spectinomycin
27 HsCD00512935 Plasmid Details cDNA CYP2S1 cytochrome P450, family 2, subfamily S, polypeptide 1 NA DQ896681 No/No FUSION pENTR223 bacterial:spectinomycin
28 HsCD00512982 Plasmid Details cDNA CYP2E1 cytochrome P450, family 2, subfamily E, polypeptide 1 NA No/No FUSION pENTR223 bacterial:spectinomycin
29 HsCD00513000 Plasmid Details cDNA CYP2A7 cytochrome P450, family 2, subfamily A, polypeptide 7 NA No/No FUSION pENTR223 bacterial:spectinomycin
30 HsCD00515839 Plasmid Details cDNA CYP2B6 cytochrome P450, family 2, subfamily B, polypeptide 6 NA No/No FUSION pENTR223 bacterial:spectinomycin
31 HsCD00630968 Plasmid Details cDNA CYP2E1 cytochrome P450, family 2, subfamily E, polypeptide 1 NA No/No FUSION pANT7_cGST bacterial:ampicillin
32 HsCD00630973 Plasmid Details cDNA CYP2B6 cytochrome P450, family 2, subfamily B, polypeptide 6 NA No/No FUSION pANT7_cGST bacterial:ampicillin
33 HsCD00639830 Plasmid Details cDNA CYP2C9 cytochrome P450, family 2, subfamily C, polypeptide 9 NA No/No FUSION pANT7_cGST bacterial:ampicillin
34 HsCD00674552 Plasmid Details cDNA CYP2D6 cytochrome P450, family 2, subfamily D, polypeptide 6 NA BC126858 No/No FUSION pANT7_cGST bacterial:ampicillin
35 HsUT00697950 Plasmid Details 3'UTR FGR FGR proto-oncogene, Src family tyrosine kinase Sequence Verified: Yes; 3'UTR length: 804; Forward Primer: CCCGGGGATCAGACATAG; Reverse Primer: CTCTGGGTGTTCTAAAACTCCACAC NM_001042747 No/No NA P2RP3 bacterial:kanamycin
36 HsCD00718772 Plasmid Details cDNA CYP2D6 cytochrome P450, family 2, subfamily D, polypeptide 6 NA BC126858 No/No FUSION pDONR221 bacterial:kanamycin
37 HsCD00719296 Plasmid Details cDNA CYP2D6 cytochrome P450, family 2, subfamily D, polypeptide 6 NA BC075024 No/No FUSION pDONR221 bacterial:kanamycin
38 HsCD00731109 Plasmid Details cDNA CYP2C8 cytochrome P450, family 2, subfamily C, polypeptide 8 NA BC020596 No/No FUSION pANT7_cGST bacterial:ampicillin
39 HsCD00731456 Plasmid Details cDNA CYP2S1 cytochrome P450, family 2, subfamily S, polypeptide 1 NA BC033691 No/No FUSION pANT7_cGST bacterial:ampicillin
40 HsCD00731616 Plasmid Details cDNA CYP2A13 cytochrome P450, family 2, subfamily A, polypeptide 13 NA NM_000766 No/No FUSION pANT7_cGST bacterial:ampicillin
41 HsCD00734524 Plasmid Details cDNA CYP2D6 cytochrome P450, family 2, subfamily D, polypeptide 6 NA CR456430 No/No FUSION pANT7_cGST bacterial:ampicillin
No of Result Per Page : Page: