DNASU Plasmid Repository • 480.965.5697 | Email

Pathways Results

TOP

Pathway : Class II GLUTs, 27 clones found

No of Result Per Page : Page: Explanation of Terms
  DNASU
Plasmid ID
Clone
Type
Gene
Symbol
Gene
Name
Keywords Reference
Sequence
Mutation/
Discrepancy
Insert
Format
Vector Selection
Markers
 
1 HsCD00040891 Plasmid Details cDNA SLC2A9 solute carrier family 2 (facilitated glucose transporter), member 9 NA BC018897 No/No FUSION pDONR221 bacterial:kanamycin
2 HsCD00041241 Plasmid Details cDNA SLC2A5 solute carrier family 2 (facilitated glucose/fructose transporter), member 5 NA BC001692 No/No FUSION pDONR221 bacterial:kanamycin
3 HsCD00044015 Plasmid Details cDNA SLC2A9 solute carrier family 2 (facilitated glucose transporter), member 9 NA BC018897 No/No CLOSED pDONR221 bacterial:kanamycin
4 HsCD00044354 Plasmid Details cDNA SLC2A5 solute carrier family 2 (facilitated glucose/fructose transporter), member 5 NA BC001692 No/No CLOSED pDONR221 bacterial:kanamycin
5 HsCD00073527 Plasmid Details cDNA SLC2A11 solute carrier family 2 (facilitated glucose transporter), member 11 NA CR456373 No/No FUSION pENTR223 bacterial:spectinomycin
6 HsCD00073621 Plasmid Details cDNA SLC2A11 solute carrier family 2 (facilitated glucose transporter), member 11 NA CR456373 No/No CLOSED pENTR223 bacterial:spectinomycin
7 HsCD00083092 Plasmid Details cDNA SLC2A7 solute carrier family 2 (facilitated glucose transporter), member 7 NA NM_207420 No/No FUSION pENTR223.1 bacterial:spectinomycin
8 HsCD00301253 Plasmid Details cDNA SLC2A11 solute carrier family 2 (facilitated glucose transporter), member 11 NA CR456373 No/No FUSION pANT7_cGST bacterial:ampicillin
9 HsCD00350741 Plasmid Details cDNA SLC2A7 solute carrier family 2 (facilitated glucose transporter), member 7 NA NM_207420 No/No CLOSED pENTR223.1 bacterial:spectinomycin
10 HsCD00350907 Plasmid Details cDNA SLC2A11 solute carrier family 2 (facilitated glucose transporter), member 11 NA CU013366 No/No FUSION pENTR223 bacterial:spectinomycin
11 HsCD00351003 Plasmid Details cDNA SLC2A11 solute carrier family 2 (facilitated glucose transporter), member 11 NA CU013078 No/No CLOSED pENTR223 bacterial:spectinomycin
12 HsCD00351460 Plasmid Details cDNA SLC2A7 solute carrier family 2 (facilitated glucose transporter), member 7 NA BC152830 No/No FUSION pENTR223.1 bacterial:spectinomycin
13 HsCD00356611 Plasmid Details cDNA SLC2A7 solute carrier family 2 (facilitated glucose transporter), member 7 NA BC152830 No/No FUSION pANT7_cGST bacterial:ampicillin
14 HsCD00402663 Plasmid Details cDNA SLC2A11 solute carrier family 2 (facilitated glucose transporter), member 11 NA CU013366 No/No FUSION pANT7_cGST bacterial:ampicillin
15 HsCD00439610 Plasmid Details cDNA SLC2A5 solute carrier family 2 (facilitated glucose/fructose transporter), member 5 NA DQ895491 No/No FUSION pLX304 mammalian:blasticidin
16 HsCD00440259 Plasmid Details cDNA SLC2A9 solute carrier family 2 (facilitated glucose transporter), member 9 NA DQ895129 No/Yes FUSION pLX304 mammalian:blasticidin
17 HsCD00444383 Plasmid Details cDNA SLC2A9 solute carrier family 2 (facilitated glucose transporter), member 9 NA No/Yes FUSION pLX304 mammalian:blasticidin
18 HsCD00445132 Plasmid Details cDNA SLC2A5 solute carrier family 2 (facilitated glucose/fructose transporter), member 5 NA DQ895491 No/No FUSION pLX304 mammalian:blasticidin
19 HsCD00446687 Plasmid Details cDNA SLC2A11 solute carrier family 2 (facilitated glucose transporter), member 11 NA CU013366 No/No FUSION pLX304 mammalian:blasticidin
20 HsCD00511638 Plasmid Details cDNA SLC2A5 solute carrier family 2 (facilitated glucose/fructose transporter), member 5 NA DQ895491 No/No FUSION pENTR223 bacterial:spectinomycin
21 HsCD00512975 Plasmid Details cDNA SLC2A5 solute carrier family 2 (facilitated glucose/fructose transporter), member 5 NA DQ895491 No/No FUSION pENTR223 bacterial:spectinomycin
22 HsCD00512997 Plasmid Details cDNA SLC2A11 solute carrier family 2 (facilitated glucose transporter), member 11 NA CU013366 No/No FUSION pENTR223 bacterial:spectinomycin
23 HsCD00513243 Plasmid Details cDNA SLC2A9 solute carrier family 2 (facilitated glucose transporter), member 9 NA DQ895129 No/Yes FUSION pENTR223 bacterial:spectinomycin
24 HsCD00620919 Plasmid Details cDNA SLC2A9 solute carrier family 2 (facilitated glucose transporter), member 9 NA BC018897 No/No FUSION pANT7_cGST bacterial:ampicillin
25 HsUT00698075 Plasmid Details 3'UTR RAF1 Raf-1 proto-oncogene, serine/threonine kinase Sequence Verified: Yes; 3'UTR length: 1093; Forward Primer: AGGCTGCCTGTCTTCTAG; Reverse Primer: AAAGAGTACAAAGGTTAAATTACAAATTCA NM_002880 No/No NA P2RP3 bacterial:kanamycin
26 HsCD00730850 Plasmid Details cDNA SLC2A5 solute carrier family 2 (facilitated glucose/fructose transporter), member 5 NA BC001692 No/No FUSION pANT7_cGST bacterial:ampicillin
27 HsCD00731710 Plasmid Details cDNA SLC2A7 solute carrier family 2 (facilitated glucose transporter), member 7 NA NM_207420 No/No FUSION pANT7_cGST bacterial:ampicillin
No of Result Per Page : Page: