DNASU Plasmid Repository • 480.965.5697 | Email

Pathways Results

TOP

Pathway : Constitutive Signaling by NOTCH1 HD Domain Mutants, 56 clones found

No of Result Per Page : Page: Explanation of Terms
  DNASU
Plasmid ID
Clone
Type
Gene
Symbol
Gene
Name
Keywords Reference
Sequence
Mutation/
Discrepancy
Insert
Format
Vector Selection
Markers
 
1 HsCD00000332 Plasmid Details cDNA UBB ubiquitin B NA NM_018955 No/Yes CLOSED pDNR-Dual bacterial:ampicillin
2 HsCD00001877 Plasmid Details cDNA UBB ubiquitin B NA BC000379 No/No FUSION pDNR-Dual bacterial:ampicillin
3 HsCD00001878 Plasmid Details cDNA UBB ubiquitin B NA BC000379 No/No CLOSED pDNR-Dual bacterial:ampicillin
4 HsCD00074284 Plasmid Details cDNA UBB ubiquitin B NA BC000379 No/No CLOSED pJP1520 mammalian:puromycin
5 HsCD00075433 Plasmid Details cDNA UBB ubiquitin B NA NM_018955 No/Yes CLOSED pJP1520 mammalian:puromycin
6 HsCD00075434 Plasmid Details cDNA UBB ubiquitin B NA NM_018955 No/Yes CLOSED pJP1520 mammalian:puromycin
7 HsCD00082584 Plasmid Details cDNA MIB2 mindbomb homolog 2 (Drosophila) NA BC037542 No/No FUSION pDONR201 bacterial:kanamycin
8 HsCD00082585 Plasmid Details cDNA MIB2 mindbomb homolog 2 (Drosophila) NA BC037542 No/Yes FUSION pDONR201 bacterial:kanamycin
9 HsCD00083077 Plasmid Details cDNA DLL1 delta-like 1 (Drosophila) NA NM_005618 No/No FUSION pENTR223.1 bacterial:spectinomycin
10 HsCD00289289 Plasmid Details cDNA RPS27A ribosomal protein S27a NA BC001392.2 No/No FUSION pENTR223 bacterial:spectinomycin
11 HsCD00330686 Plasmid Details cDNA ADAM17 ADAM metallopeptidase domain 17 full-length cds BC062687 No/No CLOSED pDONR221 bacterial:kanamycin
12 HsCD00351445 Plasmid Details cDNA DLL1 delta-like 1 (Drosophila) NA BC152803 No/No FUSION pENTR223.1 bacterial:spectinomycin
13 HsCD00353838 Plasmid Details cDNA JAG1 jagged 1 (Alagille syndrome) NA HQ258535 No/No FUSION pDONR223 bacterial:spectinomycin
14 HsCD00356597 Plasmid Details cDNA DLL1 delta-like 1 (Drosophila) NA BC152803 No/No FUSION pANT7_cGST bacterial:ampicillin
15 HsCD00383848 Plasmid Details cDNA ADAM17 ADAM metallopeptidase domain 17 partial cds BC062687 No/Yes CLOSED pDONR221 bacterial:kanamycin
16 HsCD00383854 Plasmid Details cDNA ADAM17 ADAM metallopeptidase domain 17 partial cds BC062687 No/Yes CLOSED pDONR221 bacterial:kanamycin
17 HsCD00383860 Plasmid Details cDNA ADAM17 ADAM metallopeptidase domain 17 partial cds BC062687 No/Yes CLOSED pDONR221 bacterial:kanamycin
18 HsCD00383919 Plasmid Details cDNA ADAM17 ADAM metallopeptidase domain 17 partial cds BC062687 No/Yes CLOSED pDONR221 bacterial:kanamycin
19 HsCD00403572 Plasmid Details cDNA JAG1 jagged 1 NA HQ258535 No/No FUSION pANT7_cGST bacterial:ampicillin
20 HsCD00429558 Plasmid Details cDNA ADAM17 ADAM metallopeptidase domain 17 partial cds BC062687 No/No CLOSED pVP16 bacterial:ampicillin
21 HsCD00429564 Plasmid Details cDNA ADAM17 ADAM metallopeptidase domain 17 partial cds BC062687 No/No CLOSED pVP16 bacterial:ampicillin
22 HsCD00429570 Plasmid Details cDNA ADAM17 ADAM metallopeptidase domain 17 partial cds BC062687 No/No CLOSED pVP16 bacterial:ampicillin
23 HsCD00429575 Plasmid Details cDNA ADAM17 ADAM metallopeptidase domain 17 partial cds BC062687 No/No CLOSED pVP16 bacterial:ampicillin
24 HsCD00437960 Plasmid Details cDNA UBB ubiquitin B NA No/Yes FUSION pLX304 mammalian:blasticidin
25 HsCD00440807 Plasmid Details cDNA RPS27A ribosomal protein S27a NA HQ448720 No/No FUSION pLX304 mammalian:blasticidin
26 HsCD00442296 Plasmid Details cDNA UBB ubiquitin B NA No/Yes FUSION pLX304 mammalian:blasticidin
27 HsCD00442948 Plasmid Details cDNA ADAM17 ADAM metallopeptidase domain 17 NA No/No FUSION pLX304 mammalian:blasticidin
28 HsCD00506310 Plasmid Details cDNA RPS27A ribosomal protein S27a NA HQ448720 No/No FUSION pENTR223 bacterial:spectinomycin
29 HsCD00513740 Plasmid Details cDNA ADAM17 ADAM metallopeptidase domain 17 NA No/No FUSION pENTR223 bacterial:spectinomycin
30 HsCD00515759 Plasmid Details cDNA UBA52 ubiquitin A-52 residue ribosomal protein fusion product 1 NA No/No FUSION pENTR223 bacterial:spectinomycin
31 HsCD00639070 Plasmid Details cDNA UBB ubiquitin B NA No/No FUSION pANT7_cGST bacterial:ampicillin
32 HsCD00639182 Plasmid Details cDNA ADAM17 ADAM metallopeptidase domain 17 NA No/No FUSION pANT7_cGST bacterial:ampicillin
33 HsCD00674402 Plasmid Details cDNA UBB ubiquitin B NA BC038999 No/No FUSION pANT7_cGST bacterial:ampicillin
34 HsCD00674634 Plasmid Details cDNA UBB ubiquitin B NA BC031027 No/No FUSION pANT7_cGST bacterial:ampicillin
35 HsCD00674660 Plasmid Details cDNA RPS27A ribosomal protein S27a NA BC001392 No/No FUSION pANT7_cGST bacterial:ampicillin
36 HsUT00699130 Plasmid Details 3'UTR HNF1B HNF1 homeobox B Sequence Verified: Yes; 3'UTR length: 1121; Forward Primer: TGTCCTCTACAAGCCTGGTGA; Reverse Primer: AGAGAAGGCCACCCACCTCT NM_001165923 No/No NA P2RP3 bacterial:kanamycin
37 HsCD00716981 Plasmid Details cDNA UBA52 ubiquitin A-52 residue ribosomal protein fusion product 1 NA BC101830 No/No FUSION pANT7_cGST bacterial:ampicillin
38 HsCD00717012 Plasmid Details cDNA UBA52 ubiquitin A-52 residue ribosomal protein fusion product 1 NA BC101832 No/No FUSION pANT7_cGST bacterial:ampicillin
39 HsCD00717046 Plasmid Details cDNA RPS27A ribosomal protein S27a NA BC066293 No/No FUSION pANT7_cGST bacterial:ampicillin
40 HsCD00717072 Plasmid Details cDNA UBB ubiquitin B NA BC009301 No/No FUSION pANT7_cGST bacterial:ampicillin
41 HsCD00718384 Plasmid Details cDNA UBB ubiquitin B NA BC038999 No/No FUSION pDONR221 bacterial:kanamycin
42 HsCD00718648 Plasmid Details cDNA UBA52 ubiquitin A-52 residue ribosomal protein fusion product 1 NA BC101832 No/No FUSION pDONR221 bacterial:kanamycin
43 HsCD00718649 Plasmid Details cDNA UBA52 ubiquitin A-52 residue ribosomal protein fusion product 1 NA BC101830 No/No FUSION pDONR221 bacterial:kanamycin
44 HsCD00718709 Plasmid Details cDNA RPS27A ribosomal protein S27a NA BC066293 No/No FUSION pDONR221 bacterial:kanamycin
45 HsCD00718917 Plasmid Details cDNA UBB ubiquitin B NA BC031027 No/No FUSION pDONR221 bacterial:kanamycin
46 HsCD00718976 Plasmid Details cDNA RPS27A ribosomal protein S27a NA BC001392 No/No FUSION pDONR221 bacterial:kanamycin
47 HsCD00719258 Plasmid Details cDNA UBB ubiquitin B NA BC009301 No/No FUSION pDONR221 bacterial:kanamycin
48 HsCD00719404 Plasmid Details cDNA UBB ubiquitin B NA BC000379 No/No FUSION pDONR221 bacterial:kanamycin
49 HsCD00719405 Plasmid Details cDNA UBB ubiquitin B NA BC026301 No/No FUSION pDONR221 bacterial:kanamycin
50 HsCD00731706 Plasmid Details cDNA DLL1 delta-like 1 (Drosophila) NA NM_005618 No/No FUSION pANT7_cGST bacterial:ampicillin
No of Result Per Page : Page: