DNASU Plasmid Repository • 480.965.5697 | Email

Pathways Results

TOP

Pathway : Constitutive Signaling by NOTCH1 t(7;9)(NOTCH1:M1580_K2555) Translocation Mutant, 19 clones found

No of Result Per Page : Page: Explanation of Terms
  DNASU
Plasmid ID
Clone
Type
Gene
Symbol
Gene
Name
Keywords Reference
Sequence
Mutation/
Discrepancy
Insert
Format
Vector Selection
Markers
 
1 HsCD00083077 Plasmid Details cDNA DLL1 delta-like 1 (Drosophila) NA NM_005618 No/No FUSION pENTR223.1 bacterial:spectinomycin
2 HsCD00330686 Plasmid Details cDNA ADAM17 ADAM metallopeptidase domain 17 full-length cds BC062687 No/No CLOSED pDONR221 bacterial:kanamycin
3 HsCD00351445 Plasmid Details cDNA DLL1 delta-like 1 (Drosophila) NA BC152803 No/No FUSION pENTR223.1 bacterial:spectinomycin
4 HsCD00353838 Plasmid Details cDNA JAG1 jagged 1 (Alagille syndrome) NA HQ258535 No/No FUSION pDONR223 bacterial:spectinomycin
5 HsCD00356597 Plasmid Details cDNA DLL1 delta-like 1 (Drosophila) NA BC152803 No/No FUSION pANT7_cGST bacterial:ampicillin
6 HsCD00383848 Plasmid Details cDNA ADAM17 ADAM metallopeptidase domain 17 partial cds BC062687 No/Yes CLOSED pDONR221 bacterial:kanamycin
7 HsCD00383854 Plasmid Details cDNA ADAM17 ADAM metallopeptidase domain 17 partial cds BC062687 No/Yes CLOSED pDONR221 bacterial:kanamycin
8 HsCD00383860 Plasmid Details cDNA ADAM17 ADAM metallopeptidase domain 17 partial cds BC062687 No/Yes CLOSED pDONR221 bacterial:kanamycin
9 HsCD00383919 Plasmid Details cDNA ADAM17 ADAM metallopeptidase domain 17 partial cds BC062687 No/Yes CLOSED pDONR221 bacterial:kanamycin
10 HsCD00403572 Plasmid Details cDNA JAG1 jagged 1 NA HQ258535 No/No FUSION pANT7_cGST bacterial:ampicillin
11 HsCD00429558 Plasmid Details cDNA ADAM17 ADAM metallopeptidase domain 17 partial cds BC062687 No/No CLOSED pVP16 bacterial:ampicillin
12 HsCD00429564 Plasmid Details cDNA ADAM17 ADAM metallopeptidase domain 17 partial cds BC062687 No/No CLOSED pVP16 bacterial:ampicillin
13 HsCD00429570 Plasmid Details cDNA ADAM17 ADAM metallopeptidase domain 17 partial cds BC062687 No/No CLOSED pVP16 bacterial:ampicillin
14 HsCD00429575 Plasmid Details cDNA ADAM17 ADAM metallopeptidase domain 17 partial cds BC062687 No/No CLOSED pVP16 bacterial:ampicillin
15 HsCD00442948 Plasmid Details cDNA ADAM17 ADAM metallopeptidase domain 17 NA No/No FUSION pLX304 mammalian:blasticidin
16 HsCD00513740 Plasmid Details cDNA ADAM17 ADAM metallopeptidase domain 17 NA No/No FUSION pENTR223 bacterial:spectinomycin
17 HsCD00639182 Plasmid Details cDNA ADAM17 ADAM metallopeptidase domain 17 NA No/No FUSION pANT7_cGST bacterial:ampicillin
18 HsUT00699130 Plasmid Details 3'UTR HNF1B HNF1 homeobox B Sequence Verified: Yes; 3'UTR length: 1121; Forward Primer: TGTCCTCTACAAGCCTGGTGA; Reverse Primer: AGAGAAGGCCACCCACCTCT NM_001165923 No/No NA P2RP3 bacterial:kanamycin
19 HsCD00731706 Plasmid Details cDNA DLL1 delta-like 1 (Drosophila) NA NM_005618 No/No FUSION pANT7_cGST bacterial:ampicillin
No of Result Per Page : Page: