DNASU Plasmid Repository • 480.965.5697 | Email

Pathways Results

TOP

Pathway : Crosslinking of collagen fibrils, 23 clones found

No of Result Per Page : Page: Explanation of Terms
  DNASU
Plasmid ID
Clone
Type
Gene
Symbol
Gene
Name
Keywords Reference
Sequence
Mutation/
Discrepancy
Insert
Format
Vector Selection
Markers
 
1 HsCD00039935 Plasmid Details cDNA LOXL4 lysyl oxidase-like 4 NA BC013153 No/Yes FUSION pDONR221 bacterial:kanamycin
2 HsCD00040870 Plasmid Details cDNA PCOLCE procollagen C-endopeptidase enhancer NA BC000574 No/No FUSION pDONR221 bacterial:kanamycin
3 HsCD00041668 Plasmid Details cDNA LOXL2 lysyl oxidase-like 2 NA BC000594 No/No FUSION pDONR221 bacterial:kanamycin
4 HsCD00043084 Plasmid Details cDNA LOXL4 lysyl oxidase-like 4 NA BC013153 No/Yes CLOSED pDONR221 bacterial:kanamycin
5 HsCD00043996 Plasmid Details cDNA PCOLCE procollagen C-endopeptidase enhancer NA BC000574 No/Yes CLOSED pDONR221 bacterial:kanamycin
6 HsCD00044737 Plasmid Details cDNA LOXL2 lysyl oxidase-like 2 NA BC000594 No/No CLOSED pDONR221 bacterial:kanamycin
7 HsCD00045348 Plasmid Details cDNA LOXL1 lysyl oxidase-like 1 NA BC015090 No/No CLOSED pDONR221 bacterial:kanamycin
8 HsCD00082600 Plasmid Details cDNA TLL2 tolloid-like 2 NA BC111599 No/No CLOSED pENTR223.1 bacterial:spectinomycin
9 HsCD00439816 Plasmid Details cDNA LOXL3 lysyl oxidase-like 3 NA No/No FUSION pLX304 mammalian:blasticidin
10 HsCD00441044 Plasmid Details cDNA LOXL4 lysyl oxidase-like 4 NA DQ894249 No/No FUSION pLX304 mammalian:blasticidin
11 HsCD00443880 Plasmid Details cDNA LOXL4 lysyl oxidase-like 4 NA No/Yes FUSION pLX304 mammalian:blasticidin
12 HsCD00508536 Plasmid Details cDNA LOXL4 lysyl oxidase-like 4 NA DQ894249 No/No FUSION pENTR223 bacterial:spectinomycin
13 HsCD00514164 Plasmid Details cDNA LOXL3 lysyl oxidase-like 3 NA No/No FUSION pENTR223 bacterial:spectinomycin
14 HsCD00516102 Plasmid Details cDNA LOX lysyl oxidase NA No/Yes FUSION pENTR223 bacterial:spectinomycin
15 HsCD00516391 Plasmid Details cDNA BMP1 bone morphogenetic protein 1 NA No/No FUSION pENTR223 bacterial:spectinomycin
16 HsCD00618688 Plasmid Details cDNA LOXL2 lysyl oxidase-like 2 NA BC000594 No/No FUSION pANT7_cGST bacterial:ampicillin
17 HsCD00631255 Plasmid Details cDNA BMP1 bone morphogenetic protein 1 NA No/No FUSION pANT7_cGST bacterial:ampicillin
18 HsCD00674751 Plasmid Details cDNA LOX lysyl oxidase NA BC074872 No/No FUSION pANT7_cGST bacterial:ampicillin
19 HsUT00698043 Plasmid Details 3'UTR EIF2AK3 eukaryotic translation initiation factor 2-alpha kinase 3 Sequence Verified: Yes; 3'UTR length: 1175; Forward Primer: AGCCCTTTGCCAAGCAATTAG; Reverse Primer: GAAATGATGAAAAAGATACCTGTCTGAAAT NM_004836 No/No NA P2RP3 bacterial:kanamycin
20 HsCD00719162 Plasmid Details cDNA LOX lysyl oxidase NA BC074872 No/No FUSION pDONR221 bacterial:kanamycin
21 HsCD00719436 Plasmid Details cDNA LOX lysyl oxidase NA BC089436 No/No FUSION pDONR221 bacterial:kanamycin
22 HsCD00730828 Plasmid Details cDNA PCOLCE procollagen C-endopeptidase enhancer NA BC000574 No/No FUSION pANT7_cGST bacterial:ampicillin
23 HsCD00732972 Plasmid Details cDNA LOXL4 lysyl oxidase-like 4 NA BC013153 No/No FUSION pANT7_cGST bacterial:ampicillin
No of Result Per Page : Page: