DNASU Plasmid Repository • 480.965.5697 | Email

Pathways Results


Pathway : Degradation of cysteine and homocysteine, 54 clones found

No of Result Per Page : Page: Explanation of Terms
Plasmid ID
Keywords Reference
Vector Selection
1 HsCD00002299 Plasmid Details cDNA CTH cystathionase (cystathionine gamma-lyase) NA BC015807 No/No FUSION pDNR-Dual bacterial:ampicillin
2 HsCD00002300 Plasmid Details cDNA CTH cystathionase (cystathionine gamma-lyase) NA BC015807 No/No FUSION pDNR-Dual bacterial:ampicillin
3 HsCD00002301 Plasmid Details cDNA CTH cystathionase (cystathionine gamma-lyase) NA BC015807 No/No CLOSED pDNR-Dual bacterial:ampicillin
4 HsCD00002302 Plasmid Details cDNA CTH cystathionase (cystathionine gamma-lyase) NA BC015807 No/No CLOSED pDNR-Dual bacterial:ampicillin
5 HsCD00021876 Plasmid Details cDNA TST thiosulfate sulfurtransferase (rhodanese) NA NM_003312 No/Yes CLOSED pDNR-Dual bacterial:ampicillin
6 HsCD00040311 Plasmid Details cDNA SQRDL sulfide quinone reductase-like (yeast) NA BC016836 No/No FUSION pDONR221 bacterial:kanamycin
7 HsCD00042278 Plasmid Details cDNA SLC25A10 solute carrier family 25 (mitochondrial carrier; dicarboxylate transporter), member 10 NA BC007355 No/No FUSION pDONR221 bacterial:kanamycin
8 HsCD00043463 Plasmid Details cDNA SQRDL sulfide quinone reductase-like (yeast) NA BC016836 No/No CLOSED pDONR221 bacterial:kanamycin
9 HsCD00043735 Plasmid Details cDNA CDO1 cysteine dioxygenase, type I NA BC024241 No/No CLOSED pDONR221 bacterial:kanamycin
10 HsCD00045280 Plasmid Details cDNA SLC25A10 solute carrier family 25 (mitochondrial carrier; dicarboxylate transporter), member 10 NA BC007355 No/No CLOSED pDONR221 bacterial:kanamycin
11 HsCD00073568 Plasmid Details cDNA TST thiosulfate sulfurtransferase (rhodanese) NA CR456598 No/No FUSION pENTR223 bacterial:spectinomycin
12 HsCD00073662 Plasmid Details cDNA TST thiosulfate sulfurtransferase (rhodanese) NA CR456598 No/No CLOSED pENTR223 bacterial:spectinomycin
13 HsCD00074684 Plasmid Details cDNA CTH cystathionase (cystathionine gamma-lyase) NA BC015807 No/No CLOSED pJP1520 mammalian:puromycin
14 HsCD00074685 Plasmid Details cDNA CTH cystathionase (cystathionine gamma-lyase) NA BC015807 No/No CLOSED pJP1520 mammalian:puromycin
15 HsCD00076707 Plasmid Details cDNA SQRDL sulfide quinone reductase-like (yeast) NA BC016836 No/No FUSION pANT7_cGST bacterial:ampicillin
16 HsCD00082060 Plasmid Details cDNA ETHE1 ethylmalonic encephalopathy 1 NA BC008250 No/No FUSION pDONR201 bacterial:kanamycin
17 HsCD00084459 Plasmid Details cDNA SQRDL sulfide quinone reductase-like (yeast) NA BC016836 No/No CLOSED pVP16 bacterial:ampicillin
18 HsCD00084609 Plasmid Details cDNA CDO1 cysteine dioxygenase, type I NA BC024241 No/No CLOSED pVP16 bacterial:ampicillin
19 HsCD00288900 Plasmid Details cDNA CDO1 cysteine dioxygenase, type I NA BC024241.2 No/No FUSION pENTR223 bacterial:spectinomycin
20 HsCD00296307 Plasmid Details cDNA CTH cystathionase (cystathionine gamma-lyase) NA BC015807.2 No/No CLOSED pDONR221 bacterial:kanamycin
21 HsCD00296392 Plasmid Details cDNA CTH cystathionase (cystathionine gamma-lyase) NA BC015807.2 No/No FUSION pDONR221 bacterial:kanamycin
22 HsCD00301378 Plasmid Details cDNA TST thiosulfate sulfurtransferase (rhodanese) NA CR456598 No/No FUSION pANT7_cGST bacterial:ampicillin
23 HsCD00313357 Plasmid Details cDNA CDO1 cysteine dioxygenase, type I full-length cds BC024241 No/No CLOSED pDONR221 bacterial:kanamycin
24 HsCD00351180 Plasmid Details cDNA TST thiosulfate sulfurtransferase (rhodanese) NA CU013486 No/No FUSION pENTR223 bacterial:spectinomycin
25 HsCD00351948 Plasmid Details cDNA CDO1 cysteine dioxygenase, type I NA HQ448366 No/No FUSION pDONR223 bacterial:spectinomycin
26 HsCD00356109 Plasmid Details cDNA CDO1 cysteine dioxygenase, type I NA HQ448366 No/No FUSION pANT7_cGST bacterial:ampicillin
27 HsCD00356765 Plasmid Details cDNA TST thiosulfate sulfurtransferase (rhodanese) NA CU013486 No/No FUSION pANT7_cGST bacterial:ampicillin
28 HsCD00434161 Plasmid Details cDNA SQRDL sulfide quinone reductase-like (yeast) NA No/Yes FUSION pLX304 mammalian:blasticidin
29 HsCD00434847 Plasmid Details cDNA ETHE1 ethylmalonic encephalopathy 1 NA AM392804 No/No FUSION pLX304 mammalian:blasticidin
30 HsCD00440493 Plasmid Details cDNA CTH cystathionase (cystathionine gamma-lyase) NA EU832398 No/No FUSION pLX304 mammalian:blasticidin
31 HsCD00441126 Plasmid Details cDNA SLC25A10 solute carrier family 25 (mitochondrial carrier; dicarboxylate transporter), member 10 NA DQ896592 No/No FUSION pLX304 mammalian:blasticidin
32 HsCD00441984 Plasmid Details cDNA CDO1 cysteine dioxygenase, type I NA DQ891652 No/No FUSION pLX304 mammalian:blasticidin
33 HsCD00443751 Plasmid Details cDNA SLC25A10 solute carrier family 25 (mitochondrial carrier; dicarboxylate transporter), member 10 NA DQ896592 No/No FUSION pLX304 mammalian:blasticidin
34 HsCD00446692 Plasmid Details cDNA CSAD cysteine sulfinic acid decarboxylase NA No/No FUSION pLX304 mammalian:blasticidin
35 HsCD00506888 Plasmid Details cDNA CDO1 cysteine dioxygenase, type I NA DQ891652 No/No FUSION pENTR223 bacterial:spectinomycin
36 HsCD00507957 Plasmid Details cDNA ETHE1 ethylmalonic encephalopathy 1 NA AM392804 No/No FUSION pENTR223 bacterial:spectinomycin
37 HsCD00508859 Plasmid Details cDNA SLC25A10 solute carrier family 25 (mitochondrial carrier; dicarboxylate transporter), member 10 NA DQ896592 No/No FUSION pENTR223 bacterial:spectinomycin
38 HsCD00508995 Plasmid Details cDNA SLC25A10 solute carrier family 25 (mitochondrial carrier; dicarboxylate transporter), member 10 NA DQ896592 No/No FUSION pENTR223 bacterial:spectinomycin
39 HsCD00511278 Plasmid Details cDNA CTH cystathionase (cystathionine gamma-lyase) NA EU832398 No/No FUSION pENTR223 bacterial:spectinomycin
40 HsCD00513002 Plasmid Details cDNA CSAD cysteine sulfinic acid decarboxylase NA No/No FUSION pENTR223 bacterial:spectinomycin
41 HsCD00515882 Plasmid Details cDNA SUOX sulfite oxidase NA No/No FUSION pENTR223 bacterial:spectinomycin
42 HsCD00519542 Plasmid Details cDNA SQRDL sulfide quinone reductase-like (yeast) full-length cds NM_021199 No/No CLOSED pDONR221 bacterial:kanamycin
43 HsCD00583740 Plasmid Details cDNA SUOX sulfite oxidase targeted domain No/No CLOSED pET15_NESG bacterial:ampicillin
44 HsCD00583741 Plasmid Details cDNA SUOX sulfite oxidase targeted domain No/No CLOSED pET15_NESG bacterial:ampicillin
45 HsCD00583742 Plasmid Details cDNA SUOX sulfite oxidase targeted domain No/No CLOSED pET15_NESG bacterial:ampicillin
46 HsCD00583743 Plasmid Details cDNA SUOX sulfite oxidase targeted domain No/No CLOSED pET15_NESG bacterial:ampicillin
47 HsCD00630672 Plasmid Details cDNA SUOX sulfite oxidase NA No/No FUSION pANT7_cGST bacterial:ampicillin
48 HsCD00641262 Plasmid Details cDNA CTH cystathionase (cystathionine gamma-lyase) NA BC015807 No/No FUSION pANT7_cGST bacterial:ampicillin
49 HsCD00696771 Plasmid Details cDNA SUOX sulfite oxidase targeted domain No/Yes CLOSED pET15_NESG bacterial:ampicillin
50 HsUT00699209 Plasmid Details 3'UTR GRHL3 grainyhead-like 3 (Drosophila) Sequence Verified: Yes; 3'UTR length: 1010; Forward Primer: AAAATTCAGATCATCCTTAAGGAGCTGTAA; Reverse Primer: GCCCTGCACGTCCCAGCA NM_021180 No/No NA P2RP3 bacterial:kanamycin
No of Result Per Page : Page: