DNASU Plasmid Repository • 480.965.5697 | Email

Pathways Results

TOP

Pathway : Abacavir transmembrane transport, 17 clones found

No of Result Per Page : Page: Explanation of Terms
  DNASU
Plasmid ID
Clone
Type
Gene
Symbol
Gene
Name
Keywords Reference
Sequence
Mutation/
Discrepancy
Insert
Format
Vector Selection
Markers
 
1 HsCD00005760 Plasmid Details cDNA ABCG2 ATP-binding cassette, sub-family G (WHITE), member 2 NA BC021281 No/No CLOSED pDNR-Dual bacterial:ampicillin
2 HsCD00041257 Plasmid Details cDNA ABCG2 ATP-binding cassette, sub-family G (WHITE), member 2 NA BC021281 No/No FUSION pDONR221 bacterial:kanamycin
3 HsCD00044371 Plasmid Details cDNA ABCG2 ATP-binding cassette, sub-family G (WHITE), member 2 NA BC021281 No/No CLOSED pDONR221 bacterial:kanamycin
4 HsCD00074341 Plasmid Details cDNA ABCG2 ATP-binding cassette, sub-family G (WHITE), member 2 NA BC021281 No/No CLOSED pJP1520 mammalian:puromycin
5 HsCD00082414 Plasmid Details cDNA ABCB1 ATP-binding cassette, sub-family B (MDR/TAP), member 1 NA NM_000927 No/Yes FUSION pDONR201 bacterial:kanamycin
6 HsCD00398461 Plasmid Details cDNA SLC22A1 solute carrier family 22 (organic cation transporter), member 1 NA HQ258293 No/No FUSION pDONR223 bacterial:spectinomycin
7 HsCD00404006 Plasmid Details cDNA SLC22A1 solute carrier family 22 (organic cation transporter), member 1 NA HQ258293 No/No FUSION pANT7_cGST bacterial:ampicillin
8 HsCD00442957 Plasmid Details cDNA SLC22A2 solute carrier family 22 (organic cation transporter), member 2 NA No/No FUSION pLX304 mammalian:blasticidin
9 HsCD00446595 Plasmid Details cDNA SLC22A1 solute carrier family 22 (organic cation transporter), member 1 NA HQ258293 No/No FUSION pLX304 mammalian:blasticidin
10 HsCD00513368 Plasmid Details cDNA SLC22A1 solute carrier family 22 (organic cation transporter), member 1 NA HQ258293 No/No FUSION pENTR223 bacterial:spectinomycin
11 HsCD00513846 Plasmid Details cDNA SLC22A2 solute carrier family 22 (organic cation transporter), member 2 NA No/No FUSION pENTR223 bacterial:spectinomycin
12 HsCD00583114 Plasmid Details cDNA SLC22A1 solute carrier family 22 (organic cation transporter), member 1 NA No/No FUSION pPICZa bacterial:zeocin
13 HsCD00627272 Plasmid Details cDNA ABCG2 ATP-binding cassette, sub-family G (WHITE), member 2 NA No/No FUSION pPICZa bacterial:zeocin
14 HsCD00627294 Plasmid Details cDNA SLC22A2 solute carrier family 22 (organic cation transporter), member 2 codon-optimized sequence No/Yes CLOSED pPICZa bacterial:zeocin
15 HsCD00639140 Plasmid Details cDNA SLC22A2 solute carrier family 22 (organic cation transporter), member 2 NA No/No FUSION pANT7_cGST bacterial:ampicillin
16 HsUT00699386 Plasmid Details 3'UTR ZNF860 zinc finger protein 860 Sequence Verified: Yes; 3'UTR length: 938; Forward Primer: AAGCGTGGCAAGGTCTTCAGTTAG; Reverse Primer: GCACCTGGCATTTTTTTTTTTTTAGCCT NM_001137674 No/No NA P2RP3 bacterial:kanamycin
17 HsCD00734294 Plasmid Details cDNA ABCG2 ATP-binding cassette, sub-family G (WHITE), member 2 (Junior blood group) NA BC021281 No/No FUSION pANT7_cGST bacterial:ampicillin
No of Result Per Page : Page: