DNASU Plasmid Repository • 480.965.5697 | Email

Pathways Results

TOP

Pathway : ER Quality Control Compartment (ERQC), 47 clones found

No of Result Per Page : Page: Explanation of Terms
  DNASU
Plasmid ID
Clone
Type
Gene
Symbol
Gene
Name
Keywords Reference
Sequence
Mutation/
Discrepancy
Insert
Format
Vector Selection
Markers
 
1 HsCD00040812 Plasmid Details cDNA MAN1B1 mannosidase, alpha, class 1B, member 1 NA BC002953 No/No FUSION pDONR221 bacterial:kanamycin
2 HsCD00041660 Plasmid Details cDNA EDEM1 ER degradation enhancer, mannosidase alpha-like 1 NA BC019088 No/No FUSION pDONR221 bacterial:kanamycin
3 HsCD00043934 Plasmid Details cDNA MAN1B1 mannosidase, alpha, class 1B, member 1 NA BC002953 No/No CLOSED pDONR221 bacterial:kanamycin
4 HsCD00044730 Plasmid Details cDNA EDEM1 ER degradation enhancer, mannosidase alpha-like 1 NA BC019088 No/No CLOSED pDONR221 bacterial:kanamycin
5 HsCD00077204 Plasmid Details cDNA MAN1B1 mannosidase, alpha, class 1B, member 1 NA BC002953 No/No FUSION pANT7_cGST bacterial:ampicillin
6 HsCD00295183 Plasmid Details cDNA EDEM3 ER degradation enhancer, mannosidase alpha-like 3 NA BC160020.1 No/No CLOSED pENTR223.1 bacterial:spectinomycin
7 HsCD00351299 Plasmid Details cDNA EDEM3 ER degradation enhancer, mannosidase alpha-like 3 NA BC160020 No/No CLOSED pENTR223.1 bacterial:spectinomycin
8 HsCD00358301 Plasmid Details cDNA EDEM2 ER degradation enhancer, mannosidase alpha-like 2 partial cds (N-terminal deletion) BC001371 Yes/No CLOSED pDONR221 bacterial:kanamycin
9 HsCD00358375 Plasmid Details cDNA MAN1B1 mannosidase, alpha, class 1B, member 1 partial cds (N-terminal deletion) BC002953 Yes/No CLOSED pDONR221 bacterial:kanamycin
10 HsCD00358419 Plasmid Details cDNA EDEM1 ER degradation enhancer, mannosidase alpha-like 1 partial cds (N-terminal deletion) BC019088 Yes/No CLOSED pDONR221 bacterial:kanamycin
11 HsCD00413106 Plasmid Details cDNA EDEM2 ER degradation enhancer, mannosidase alpha-like 2 partial cds (N-terminal deletion) BC001371 Yes/No CLOSED pGEn2-DEST bacterial:ampicillin
12 HsCD00413143 Plasmid Details cDNA MAN1B1 mannosidase, alpha, class 1B, member 1 partial cds (N-terminal deletion) BC002953 Yes/No CLOSED pGEn2-DEST bacterial:ampicillin
13 HsCD00413195 Plasmid Details cDNA EDEM1 ER degradation enhancer, mannosidase alpha-like 1 partial cds (N-terminal deletion) BC019088 Yes/No CLOSED pGEn2-DEST bacterial:ampicillin
14 HsCD00413286 Plasmid Details cDNA EDEM2 ER degradation enhancer, mannosidase alpha-like 2 partial cds (N-terminal deletion) BC001371 Yes/No CLOSED pGEn1-DEST bacterial:ampicillin
15 HsCD00413324 Plasmid Details cDNA MAN1B1 mannosidase, alpha, class 1B, member 1 partial cds (N-terminal deletion) BC002953 Yes/No CLOSED pGEn1-DEST bacterial:ampicillin
16 HsCD00413382 Plasmid Details cDNA EDEM1 ER degradation enhancer, mannosidase alpha-like 1 partial cds (N-terminal deletion) BC019088 Yes/No CLOSED pGEn1-DEST bacterial:ampicillin
17 HsCD00433830 Plasmid Details cDNA UGGT2 UDP-glucose glycoprotein glucosyltransferase 2 NA No/No FUSION pLX304 mammalian:blasticidin
18 HsCD00440552 Plasmid Details cDNA EDEM2 ER degradation enhancer, mannosidase alpha-like 2 NA No/No FUSION pLX304 mammalian:blasticidin
19 HsCD00440646 Plasmid Details cDNA EDEM3 ER degradation enhancer, mannosidase alpha-like 3 NA BC160020 No/No FUSION pLX304 mammalian:blasticidin
20 HsCD00442979 Plasmid Details cDNA MAN1B1 mannosidase, alpha, class 1B, member 1 NA DQ895050 No/No FUSION pLX304 mammalian:blasticidin
21 HsCD00444100 Plasmid Details cDNA MAN1B1 mannosidase, alpha, class 1B, member 1 NA DQ895050 No/No FUSION pLX304 mammalian:blasticidin
22 HsCD00446161 Plasmid Details cDNA UGGT2 UDP-glucose glycoprotein glucosyltransferase 2 NA No/No FUSION pLX304 mammalian:blasticidin
23 HsCD00451152 Plasmid Details cDNA EDEM2 ER degradation enhancer, mannosidase alpha-like 2 NA BC001371 No/No FUSION pDONR221 bacterial:kanamycin
24 HsCD00504966 Plasmid Details cDNA EDEM3 ER degradation enhancer, mannosidase alpha-like 3 NA BC160020 No/No FUSION pENTR223 bacterial:spectinomycin
25 HsCD00505324 Plasmid Details cDNA UGGT2 UDP-glucose glycoprotein glucosyltransferase 2 NA No/No FUSION pENTR223 bacterial:spectinomycin
26 HsCD00505477 Plasmid Details cDNA MAN1B1 mannosidase, alpha, class 1B, member 1 NA DQ895050 No/No FUSION pENTR223 bacterial:spectinomycin
27 HsCD00509721 Plasmid Details cDNA UGGT2 UDP-glucose glycoprotein glucosyltransferase 2 NA No/No FUSION pENTR223 bacterial:spectinomycin
28 HsCD00513515 Plasmid Details cDNA MAN1B1 mannosidase, alpha, class 1B, member 1 NA DQ895050 No/No FUSION pENTR223 bacterial:spectinomycin
29 HsCD00513978 Plasmid Details cDNA EDEM2 ER degradation enhancer, mannosidase alpha-like 2 NA No/No FUSION pENTR223 bacterial:spectinomycin
30 HsCD00521121 Plasmid Details cDNA EDEM2 ER degradation enhancer, mannosidase alpha-like 2 full-length cds BC001371 No/No FUSION pGEc1-DEST
31 HsCD00521200 Plasmid Details cDNA EDEM2 ER degradation enhancer, mannosidase alpha-like 2 full-length cds BC001371 No/No FUSION pGEc2-DEST bacterial:ampicillin
32 HsCD00522275 Plasmid Details cDNA UGGT1 UDP-glucose glycoprotein glucosyltransferase 1 NA BC041098 No/No CLOSED pGEn2-DEST
33 HsCD00522280 Plasmid Details cDNA EDEM3 ER degradation enhancer, mannosidase alpha-like 3 full-length cds BC144149 No/No CLOSED pGEn2-DEST
34 HsCD00522334 Plasmid Details cDNA UGGT1 UDP-glucose glycoprotein glucosyltransferase 1 NA BC041098 No/No CLOSED pGEn1-DEST
35 HsCD00522340 Plasmid Details cDNA EDEM3 ER degradation enhancer, mannosidase alpha-like 3 full-length cds BC144149 No/No CLOSED pGEn1-DEST
36 HsCD00522351 Plasmid Details cDNA EDEM3 ER degradation enhancer, mannosidase alpha-like 3 full-length cds BC144149 No/No CLOSED pDONR221 bacterial:kanamycin
37 HsCD00522429 Plasmid Details cDNA EDEM2 ER degradation enhancer, mannosidase alpha-like 2 partial cds (N-terminal deletion) BC001371 Yes/No CLOSED pGEn3-DEST bacterial:ampicillin
38 HsCD00522466 Plasmid Details cDNA MAN1B1 mannosidase, alpha, class 1B, member 1 partial cds (N-terminal deletion) BC002953 Yes/No CLOSED pGEn3-DEST bacterial:ampicillin
39 HsCD00522523 Plasmid Details cDNA EDEM1 ER degradation enhancer, mannosidase alpha-like 1 partial cds (N-terminal deletion) BC019088 Yes/No CLOSED pGEn3-DEST bacterial:ampicillin
40 HsCD00522571 Plasmid Details cDNA UGGT1 UDP-glucose glycoprotein glucosyltransferase 1 NA BC041098 No/No CLOSED pGEn3-DEST bacterial:ampicillin
41 HsCD00522578 Plasmid Details cDNA EDEM3 ER degradation enhancer, mannosidase alpha-like 3 full-length cds BC144149 No/No CLOSED pGEn3-DEST bacterial:ampicillin
42 HsCD00522646 Plasmid Details cDNA UGGT1 UDP-glucose glycoprotein glucosyltransferase 1 NA BC041098 No/No CLOSED pDONR221 bacterial:kanamycin
43 HsCD00640676 Plasmid Details cDNA EDEM2 ER degradation enhancer, mannosidase alpha-like 2 NA NM_018217 No/No FUSION pANT7_cGST bacterial:ampicillin
44 HsUT00698650 Plasmid Details 3'UTR ZNF323 zinc finger and SCAN domain containing 31 Sequence Verified: Yes; 3'UTR length: 1608; Forward Primer: CAGAAAATCCACACTGGAGAGAGACCATAA; Reverse Primer: TCAGCTAATTGCTAATGTTCTATTGACAAA NM_001243241 No/No NA P2RP3 bacterial:kanamycin
45 HsCD00730942 Plasmid Details cDNA EDEM1 ER degradation enhancer, mannosidase alpha-like 1 NA BC019088 No/No FUSION pANT7_cGST bacterial:ampicillin
46 HsCD00734780 Plasmid Details cDNA EDEM2 ER degradation enhancer, mannosidase alpha-like 2 NA BC001371 No/No FUSION pANT7_cGST bacterial:ampicillin
47 HsCD00734789 Plasmid Details cDNA UGGT2 UDP-glucose glycoprotein glucosyltransferase 2 NA No/No FUSION pANT7_cGST bacterial:ampicillin
No of Result Per Page : Page: