DNASU Plasmid Repository • 480.965.5697 | Email

Pathways Results


Pathway : Eicosanoid ligand-binding receptors, 62 clones found

No of Result Per Page : Page: Explanation of Terms
Plasmid ID
Keywords Reference
Vector Selection
1 HsCD00001381 Plasmid Details cDNA PTGFR prostaglandin F receptor (FP) NA NM_000959 No/Yes CLOSED pDONR201 bacterial:kanamycin
2 HsCD00003891 Plasmid Details cDNA LTB4R leukotriene B4 receptor NA BC004545 No/Yes FUSION pDNR-Dual bacterial:ampicillin
3 HsCD00003892 Plasmid Details cDNA LTB4R leukotriene B4 receptor NA BC004545 No/Yes CLOSED pDNR-Dual bacterial:ampicillin
4 HsCD00005735 Plasmid Details cDNA PTGFR prostaglandin F receptor (FP) NA BC035694 No/No FUSION pDNR-Dual bacterial:ampicillin
5 HsCD00039485 Plasmid Details cDNA LTB4R leukotriene B4 receptor NA BC004545 No/Yes FUSION pDONR221 bacterial:kanamycin
6 HsCD00039806 Plasmid Details cDNA PTGFR prostaglandin F receptor (FP) NA BC035694 No/No FUSION pDONR221 bacterial:kanamycin
7 HsCD00041415 Plasmid Details cDNA GPR17 G protein-coupled receptor 17 NA BC031653 No/No FUSION pDONR221 bacterial:kanamycin
8 HsCD00042964 Plasmid Details cDNA CYSLTR1 cysteinyl leukotriene receptor 1 NA BC035750 No/No CLOSED pDONR221 bacterial:kanamycin
9 HsCD00042974 Plasmid Details cDNA PTGFR prostaglandin F receptor (FP) NA BC035694 No/No CLOSED pDONR221 bacterial:kanamycin
10 HsCD00044516 Plasmid Details cDNA GPR17 G protein-coupled receptor 17 NA BC031653 No/No CLOSED pDONR221 bacterial:kanamycin
11 HsCD00075896 Plasmid Details cDNA LTB4R leukotriene B4 receptor NA BC004545 No/Yes CLOSED pDONR221 bacterial:kanamycin
12 HsCD00075944 Plasmid Details cDNA CYSLTR1 cysteinyl leukotriene receptor 1 NA BC035750 No/No FUSION pDONR221 bacterial:kanamycin
13 HsCD00078410 Plasmid Details cDNA LTB4R leukotriene B4 receptor NA BC004545 No/Yes FUSION pANT7_cGST bacterial:ampicillin
14 HsCD00288183 Plasmid Details cDNA PTGER3 prostaglandin E receptor 3 (subtype EP3) NA BC024229.1 No/No FUSION pENTR223 bacterial:spectinomycin
15 HsCD00304857 Plasmid Details cDNA CYSLTR2 cysteinyl leukotriene receptor 2 NA NM_020377 Unknown/Unknown FUSION pDONR201 bacterial:kanamycin
16 HsCD00304883 Plasmid Details cDNA CYSLTR2 cysteinyl leukotriene receptor 2 NA NM_020377 Unknown/Unknown FUSION pDONR201 bacterial:kanamycin
17 HsCD00304941 Plasmid Details cDNA PTGIR prostaglandin I2 (prostacyclin) receptor (IP) NA NM_000960 Unknown/Unknown FUSION pDONR201 bacterial:kanamycin
18 HsCD00304942 Plasmid Details cDNA PTGER2 prostaglandin E receptor 2 (subtype EP2), 53kDa NA NM_000956 Unknown/Unknown FUSION pDONR201 bacterial:kanamycin
19 HsCD00305113 Plasmid Details cDNA GPR17 G protein-coupled receptor 17 NA NM_005291 Unknown/Unknown FUSION pDONR201 bacterial:kanamycin
20 HsCD00305144 Plasmid Details cDNA LTB4R leukotriene B4 receptor NA NM_000752.1 Unknown/Unknown FUSION pDONR201 bacterial:kanamycin
21 HsCD00305151 Plasmid Details cDNA PTGFR prostaglandin F receptor (FP) NA NM_000959 Unknown/Unknown FUSION pDONR201 bacterial:kanamycin
22 HsCD00305155 Plasmid Details cDNA PTGER1 prostaglandin E receptor 1 (subtype EP1), 42kDa NA NM_000955 Unknown/Unknown FUSION pDONR201 bacterial:kanamycin
23 HsCD00305172 Plasmid Details cDNA GPR44 G protein-coupled receptor 44 NA NM_004778 Unknown/Unknown FUSION pDONR201 bacterial:kanamycin
24 HsCD00305296 Plasmid Details cDNA PTGER2 prostaglandin E receptor 2 (subtype EP2), 53kDa NA NM_000956 Unknown/Unknown FUSION pANT7_cGST bacterial:ampicillin
25 HsCD00305612 Plasmid Details cDNA LTB4R leukotriene B4 receptor NA NM_000752.1 Unknown/Unknown FUSION pANT7_cGST bacterial:ampicillin
26 HsCD00352712 Plasmid Details cDNA PTGER3 prostaglandin E receptor 3 (subtype EP3) NA HQ447638 No/No FUSION pDONR223 bacterial:spectinomycin
27 HsCD00353806 Plasmid Details cDNA PTGER4 prostaglandin E receptor 4 (subtype EP4) NA HQ258444 No/No FUSION pDONR223 bacterial:spectinomycin
28 HsCD00353860 Plasmid Details cDNA LTB4R2 leukotriene B4 receptor 2 NA BC172240 No/No FUSION pENTR223.1 bacterial:spectinomycin
29 HsCD00353976 Plasmid Details cDNA LTB4R2 leukotriene B4 receptor 2 NA BC172548 No/No CLOSED pENTR223.1 bacterial:spectinomycin
30 HsCD00357885 Plasmid Details cDNA PTGER3 prostaglandin E receptor 3 (subtype EP3) NA HQ447638 No/No FUSION pANT7_cGST bacterial:ampicillin
31 HsCD00403284 Plasmid Details cDNA LTB4R2 leukotriene B4 receptor 2 NA BC172240 No/No FUSION pANT7_cGST bacterial:ampicillin
32 HsCD00403541 Plasmid Details cDNA PTGER4 prostaglandin E receptor 4 (subtype EP4) NA HQ258444 No/No FUSION pANT7_cGST bacterial:ampicillin
33 HsCD00434716 Plasmid Details cDNA GPR17 G protein-coupled receptor 17 NA DQ895665 No/No FUSION pLX304 mammalian:blasticidin
34 HsCD00434730 Plasmid Details cDNA CYSLTR1 cysteinyl leukotriene receptor 1 NA No/Yes FUSION pLX304 mammalian:blasticidin
35 HsCD00436359 Plasmid Details cDNA LTB4R leukotriene B4 receptor NA No/Yes FUSION pLX304 mammalian:blasticidin
36 HsCD00443435 Plasmid Details cDNA PTGER3 prostaglandin E receptor 3 (subtype EP3) NA HQ447638 No/No FUSION pLX304 mammalian:blasticidin
37 HsCD00446102 Plasmid Details cDNA PTGIR prostaglandin I2 (prostacyclin) receptor (IP) NA No/No FUSION pLX304 mammalian:blasticidin
38 HsCD00446706 Plasmid Details cDNA PTGER4 prostaglandin E receptor 4 (subtype EP4) NA HQ258444 No/No FUSION pLX304 mammalian:blasticidin
39 HsCD00510113 Plasmid Details cDNA GPR17 G protein-coupled receptor 17 NA DQ895665 No/No FUSION pENTR223 bacterial:spectinomycin
40 HsCD00511884 Plasmid Details cDNA PTGER3 prostaglandin E receptor 3 (subtype EP3) NA HQ447638 No/No FUSION pENTR223 bacterial:spectinomycin
41 HsCD00513013 Plasmid Details cDNA PTGER4 prostaglandin E receptor 4 (subtype EP4) NA HQ258444 No/No FUSION pENTR223 bacterial:spectinomycin
42 HsCD00515133 Plasmid Details cDNA TBXA2R thromboxane A2 receptor NA No/No FUSION pENTR223 bacterial:spectinomycin
43 HsCD00515548 Plasmid Details cDNA PTGDR prostaglandin D2 receptor (DP) NA No/No FUSION pENTR223 bacterial:spectinomycin
44 HsCD00515663 Plasmid Details cDNA OXER1 oxoeicosanoid (OXE) receptor 1 NA No/No FUSION pENTR223 bacterial:spectinomycin
45 HsCD00622758 Plasmid Details cDNA PTGIR prostaglandin I2 (prostacyclin) receptor (IP) PERFECT_MATCH BC075814.1 No/No FUSION pENTR223 bacterial:spectinomycin
46 HsCD00631018 Plasmid Details cDNA PTGDR prostaglandin D2 receptor (DP) NA No/No FUSION pANT7_cGST bacterial:ampicillin
47 HsCD00639348 Plasmid Details cDNA TBXA2R thromboxane A2 receptor NA No/No FUSION pANT7_cGST bacterial:ampicillin
48 HsCD00674759 Plasmid Details cDNA TBXA2R thromboxane A2 receptor NA BC074749 No/No FUSION pANT7_cGST bacterial:ampicillin
49 HsUT00698717 Plasmid Details 3'UTR ZNF193 zinc finger and SCAN domain containing 9 Sequence Verified: Yes; 3'UTR length: 488; Forward Primer: GTGGCTGAGCTGGTCTAG; Reverse Primer: GAGAGTCACGTAGGTGTCAGAGAGAA NM_001199480 No/No NA P2RP3 bacterial:kanamycin
50 HsCD00719173 Plasmid Details cDNA TBXA2R thromboxane A2 receptor NA BC074749 No/No FUSION pDONR221 bacterial:kanamycin
No of Result Per Page : Page: