DNASU Plasmid Repository • 480.965.5697 | Email

Pathways Results

TOP

Pathway : Extrinsic Pathway, 18 clones found

No of Result Per Page : Page: Explanation of Terms
  DNASU
Plasmid ID
Clone
Type
Gene
Symbol
Gene
Name
Keywords Reference
Sequence
Mutation/
Discrepancy
Insert
Format
Vector Selection
Markers
 
1 MmCD00080816 Plasmid Details cDNA F9 coagulation factor IX NA NM_007979 No/No FUSION pENTR223.1 bacterial:spectinomycin
2 MmCD00083442 Plasmid Details cDNA F9 coagulation factor IX NA NM_007979 No/No CLOSED pENTR223.1 bacterial:spectinomycin
3 HsCD00287668 Plasmid Details cDNA TFPI tissue factor pathway inhibitor (lipoprotein-associated coagulation inhibitor) NA BC015514.1 No/No FUSION pENTR223 bacterial:spectinomycin
4 HsCD00343244 Plasmid Details cDNA F3 coagulation factor III (thromboplastin, tissue factor) NA BC011029 No/Yes CLOSED pMCSG7 bacterial:ampicillin
5 HsCD00353510 Plasmid Details cDNA TFPI tissue factor pathway inhibitor (lipoprotein-associated coagulation inhibitor) NA HQ447091 No/No FUSION pDONR223 bacterial:spectinomycin
6 HsCD00357256 Plasmid Details cDNA TFPI tissue factor pathway inhibitor (lipoprotein-associated coagulation inhibitor) NA HQ447091 No/No FUSION pANT7_cGST bacterial:ampicillin
7 HsCD00435926 Plasmid Details cDNA F10 coagulation factor X NA No/No FUSION pLX304 mammalian:blasticidin
8 HsCD00436315 Plasmid Details cDNA F3 coagulation factor III (thromboplastin, tissue factor) NA DQ892755 No/No FUSION pLX304 mammalian:blasticidin
9 HsCD00436695 Plasmid Details cDNA F9 coagulation factor IX NA BC146406 No/No FUSION pLX304 mammalian:blasticidin
10 HsCD00437370 Plasmid Details cDNA TFPI tissue factor pathway inhibitor (lipoprotein-associated coagulation inhibitor) NA HQ447091 No/Yes FUSION pLX304 mammalian:blasticidin
11 HsCD00507976 Plasmid Details cDNA TFPI tissue factor pathway inhibitor (lipoprotein-associated coagulation inhibitor) NA HQ447091 No/Yes FUSION pENTR223 bacterial:spectinomycin
12 HsCD00509662 Plasmid Details cDNA F3 coagulation factor III (thromboplastin, tissue factor) NA DQ892755 No/No FUSION pENTR223 bacterial:spectinomycin
13 HsCD00512108 Plasmid Details cDNA F9 coagulation factor IX NA BC146406 No/No FUSION pENTR223 bacterial:spectinomycin
14 HsCD00513788 Plasmid Details cDNA F10 coagulation factor X NA No/No FUSION pENTR223 bacterial:spectinomycin
15 HsCD00630982 Plasmid Details cDNA F10 coagulation factor X NA No/No FUSION pANT7_cGST bacterial:ampicillin
16 HsCD00631038 Plasmid Details cDNA F9 coagulation factor IX NA No/No FUSION pANT7_cGST bacterial:ampicillin
17 HsUT00698982 Plasmid Details 3'UTR TFG TRK-fused gene Sequence Verified: Yes; 3'UTR length: 616; Forward Primer: ACCTGGACCTGGTTATCGATA; Reverse Primer: ACCAAATGGCACTGTTTTCTCTGAAT NM_001195479 No/No NA P2RP3 bacterial:kanamycin
18 HsCD00730104 Plasmid Details cDNA TFPI tissue factor pathway inhibitor (lipoprotein-associated coagulation inhibitor) NA BC015514 No/No FUSION pANT7_cGST bacterial:ampicillin
No of Result Per Page : Page: