DNASU Plasmid Repository • 480.965.5697 | Email

Pathways Results

TOP

Pathway : Fatty acids, 52 clones found

No of Result Per Page : Page: Explanation of Terms
  DNASU
Plasmid ID
Clone
Type
Gene
Symbol
Gene
Name
Keywords Reference
Sequence
Mutation/
Discrepancy
Insert
Format
Vector Selection
Markers
 
1 HsCD00039651 Plasmid Details cDNA CYP4F12 cytochrome P450, family 4, subfamily F, polypeptide 12 NA BC035350 No/Yes FUSION pDONR221 bacterial:kanamycin
2 HsCD00039703 Plasmid Details cDNA CYP2J2 cytochrome P450, family 2, subfamily J, polypeptide 2 NA BC032594 No/No FUSION pDONR221 bacterial:kanamycin
3 HsCD00040336 Plasmid Details cDNA CYP4F11 cytochrome P450, family 4, subfamily F, polypeptide 11 NA BC016853 No/No FUSION pDONR221 bacterial:kanamycin
4 HsCD00040961 Plasmid Details cDNA CYP4B1 cytochrome P450, family 4, subfamily B, polypeptide 1 NA BC017758 No/No FUSION pDONR221 bacterial:kanamycin
5 HsCD00042827 Plasmid Details cDNA CYP4F12 cytochrome P450, family 4, subfamily F, polypeptide 12 NA BC035350 No/Yes CLOSED pDONR221 bacterial:kanamycin
6 HsCD00042879 Plasmid Details cDNA CYP2J2 cytochrome P450, family 2, subfamily J, polypeptide 2 NA BC032594 No/No CLOSED pDONR221 bacterial:kanamycin
7 HsCD00043484 Plasmid Details cDNA CYP4F11 cytochrome P450, family 4, subfamily F, polypeptide 11 NA BC016853 No/No CLOSED pDONR221 bacterial:kanamycin
8 HsCD00044083 Plasmid Details cDNA CYP4B1 cytochrome P450, family 4, subfamily B, polypeptide 1 NA BC017758 No/No CLOSED pDONR221 bacterial:kanamycin
9 HsCD00073953 Plasmid Details cDNA CYP2D6 cytochrome P450, family 2, subfamily D, polypeptide 6 NA CR456430 No/No FUSION pENTR223 bacterial:spectinomycin
10 HsCD00074047 Plasmid Details cDNA CYP2D6 cytochrome P450, family 2, subfamily D, polypeptide 6 NA CR456430 No/No CLOSED pENTR223 bacterial:spectinomycin
11 HsCD00077385 Plasmid Details cDNA CYP4F12 cytochrome P450, family 4, subfamily F, polypeptide 12 NA BC035350 No/Yes FUSION pANT7_cGST bacterial:ampicillin
12 HsCD00080226 Plasmid Details cDNA CYP2A13 cytochrome P450, family 2, subfamily A, polypeptide 13 NA NM_000766 No/No FUSION pENTR223.1 bacterial:spectinomycin
13 HsCD00080320 Plasmid Details cDNA CYP4F8 cytochrome P450, family 4, subfamily F, polypeptide 8 NA NM_007253 No/No FUSION pENTR223.1 bacterial:spectinomycin
14 HsCD00082773 Plasmid Details cDNA CYP4F8 cytochrome P450, family 4, subfamily F, polypeptide 8 NA NM_007253 No/No CLOSED pENTR223.1 bacterial:spectinomycin
15 HsCD00082918 Plasmid Details cDNA CYP2A13 cytochrome P450, family 2, subfamily A, polypeptide 13 NA NM_000766 No/No CLOSED pENTR223.1 bacterial:spectinomycin
16 HsCD00350449 Plasmid Details cDNA CYP4F8 cytochrome P450, family 4, subfamily F, polypeptide 8 NA BC156576 No/No CLOSED pENTR223.1 bacterial:spectinomycin
17 HsCD00350867 Plasmid Details cDNA CYP2D6 cytochrome P450, family 2, subfamily D, polypeptide 6 NA CU013213 No/No CLOSED pENTR223 bacterial:spectinomycin
18 HsCD00351251 Plasmid Details cDNA CYP2D6 cytochrome P450, family 2, subfamily D, polypeptide 6 NA CU013501 No/No FUSION pENTR223 bacterial:spectinomycin
19 HsCD00398451 Plasmid Details cDNA CYP2A7 cytochrome P450, family 2, subfamily A, polypeptide 7 NA HQ258268 No/No FUSION pDONR223 bacterial:spectinomycin
20 HsCD00402628 Plasmid Details cDNA CYP2D6 cytochrome P450, family 2, subfamily D, polypeptide 6 NA CU013501 No/No FUSION pANT7_cGST bacterial:ampicillin
21 HsCD00403997 Plasmid Details cDNA CYP2A7 cytochrome P450, family 2, subfamily A, polypeptide 7 NA HQ258268 No/No FUSION pANT7_cGST bacterial:ampicillin
22 HsCD00435394 Plasmid Details cDNA CYP4F12 cytochrome P450, family 4, subfamily F, polypeptide 12 NA DQ893965 No/Yes FUSION pLX304 mammalian:blasticidin
23 HsCD00436784 Plasmid Details cDNA CYP2F1 cytochrome P450, family 2, subfamily F, polypeptide 1 NA No/Yes FUSION pLX304 mammalian:blasticidin
24 HsCD00442453 Plasmid Details cDNA CYP2J2 cytochrome P450, family 2, subfamily J, polypeptide 2 NA DQ894017 No/No FUSION pLX304 mammalian:blasticidin
25 HsCD00442861 Plasmid Details cDNA CYP4B1 cytochrome P450, family 4, subfamily B, polypeptide 1 NA DQ895199 No/No FUSION pLX304 mammalian:blasticidin
26 HsCD00445160 Plasmid Details cDNA CYP4F11 cytochrome P450, family 4, subfamily F, polypeptide 11 NA DQ894650 No/No FUSION pLX304 mammalian:blasticidin
27 HsCD00445825 Plasmid Details cDNA CYP4A11 cytochrome P450, family 4, subfamily A, polypeptide 11 NA No/Yes FUSION pLX304 mammalian:blasticidin
28 HsCD00446690 Plasmid Details cDNA CYP2A7 cytochrome P450, family 2, subfamily A, polypeptide 7 NA No/No FUSION pLX304 mammalian:blasticidin
29 HsCD00512502 Plasmid Details cDNA CYP4B1 cytochrome P450, family 4, subfamily B, polypeptide 1 NA DQ895199 No/No FUSION pENTR223 bacterial:spectinomycin
30 HsCD00513000 Plasmid Details cDNA CYP2A7 cytochrome P450, family 2, subfamily A, polypeptide 7 NA No/No FUSION pENTR223 bacterial:spectinomycin
31 HsCD00513132 Plasmid Details cDNA CYP4F12 cytochrome P450, family 4, subfamily F, polypeptide 12 NA DQ893965 No/Yes FUSION pENTR223 bacterial:spectinomycin
32 HsCD00513183 Plasmid Details cDNA CYP4F11 cytochrome P450, family 4, subfamily F, polypeptide 11 NA DQ894650 No/No FUSION pENTR223 bacterial:spectinomycin
33 HsCD00513828 Plasmid Details cDNA CYP2J2 cytochrome P450, family 2, subfamily J, polypeptide 2 NA DQ894017 No/No FUSION pENTR223 bacterial:spectinomycin
34 HsCD00515709 Plasmid Details cDNA CYP4A22 cytochrome P450, family 4, subfamily A, polypeptide 22 NA No/No FUSION pENTR223 bacterial:spectinomycin
35 HsCD00515839 Plasmid Details cDNA CYP2B6 cytochrome P450, family 2, subfamily B, polypeptide 6 NA No/No FUSION pENTR223 bacterial:spectinomycin
36 HsCD00515892 Plasmid Details cDNA CYP4F2 cytochrome P450, family 4, subfamily F, polypeptide 2 NA No/No FUSION pENTR223 bacterial:spectinomycin
37 HsCD00630973 Plasmid Details cDNA CYP2B6 cytochrome P450, family 2, subfamily B, polypeptide 6 NA No/No FUSION pANT7_cGST bacterial:ampicillin
38 HsCD00639274 Plasmid Details cDNA CYP4A11 cytochrome P450, family 4, subfamily A, polypeptide 11 NA No/No FUSION pANT7_cGST bacterial:ampicillin
39 HsCD00639545 Plasmid Details cDNA CYP4A11 cytochrome P450, family 4, subfamily A, polypeptide 11 NA No/No FUSION pANT7_cGST bacterial:ampicillin
40 HsCD00640094 Plasmid Details cDNA CYP4F2 cytochrome P450, family 4, subfamily F, polypeptide 2 NA NM_001082 No/No FUSION pANT7_cGST bacterial:ampicillin
41 HsCD00674552 Plasmid Details cDNA CYP2D6 cytochrome P450, family 2, subfamily D, polypeptide 6 NA BC126858 No/No FUSION pANT7_cGST bacterial:ampicillin
42 HsCD00674776 Plasmid Details cDNA CYP4F22 cytochrome P450, family 4, subfamily F, polypeptide 22 NA BC093894 No/No FUSION pANT7_cGST bacterial:ampicillin
43 HsUT00697950 Plasmid Details 3'UTR FGR FGR proto-oncogene, Src family tyrosine kinase Sequence Verified: Yes; 3'UTR length: 804; Forward Primer: CCCGGGGATCAGACATAG; Reverse Primer: CTCTGGGTGTTCTAAAACTCCACAC NM_001042747 No/No NA P2RP3 bacterial:kanamycin
44 HsCD00718772 Plasmid Details cDNA CYP2D6 cytochrome P450, family 2, subfamily D, polypeptide 6 NA BC126858 No/No FUSION pDONR221 bacterial:kanamycin
45 HsCD00719199 Plasmid Details cDNA CYP4F22 cytochrome P450, family 4, subfamily F, polypeptide 22 NA BC093894 No/No FUSION pDONR221 bacterial:kanamycin
46 HsCD00719296 Plasmid Details cDNA CYP2D6 cytochrome P450, family 2, subfamily D, polypeptide 6 NA BC075024 No/No FUSION pDONR221 bacterial:kanamycin
47 HsCD00731099 Plasmid Details cDNA CYP4F11 cytochrome P450, family 4, subfamily F, polypeptide 11 NA BC016853 No/No FUSION pANT7_cGST bacterial:ampicillin
48 HsCD00731162 Plasmid Details cDNA CYP4B1 cytochrome P450, family 4, subfamily B, polypeptide 1 NA BC017758 No/No FUSION pANT7_cGST bacterial:ampicillin
49 HsCD00731436 Plasmid Details cDNA CYP2J2 cytochrome P450, family 2, subfamily J, polypeptide 2 NA BC032594 No/No FUSION pANT7_cGST bacterial:ampicillin
50 HsCD00731616 Plasmid Details cDNA CYP2A13 cytochrome P450, family 2, subfamily A, polypeptide 13 NA NM_000766 No/No FUSION pANT7_cGST bacterial:ampicillin
No of Result Per Page : Page: