DNASU Plasmid Repository • 480.965.5697 | Email

Pathways Results

TOP

Pathway : Activation of C3 and C5, 7 clones found

No of Result Per Page : Page: Explanation of Terms
  DNASU
Plasmid ID
Clone
Type
Gene
Symbol
Gene
Name
Keywords Reference
Sequence
Mutation/
Discrepancy
Insert
Format
Vector Selection
Markers
 
1 HsCD00399161 Plasmid Details cDNA C4B complement component 4B (Chido blood group) NA BC172377 No/No CLOSED pENTR223.1 bacterial:spectinomycin
2 HsCD00444098 Plasmid Details cDNA CFB complement factor B NA DQ895516 No/No FUSION pLX304 mammalian:blasticidin
3 HsCD00505660 Plasmid Details cDNA CFB complement factor B NA DQ895516 No/No FUSION pENTR223 bacterial:spectinomycin
4 HsCD00516245 Plasmid Details cDNA C2 complement component 2 NA No/No FUSION pENTR223 bacterial:spectinomycin
5 HsCD00640958 Plasmid Details cDNA C2 complement component 2 NA NM_000063 No/No FUSION pANT7_cGST bacterial:ampicillin
6 HsUT00699370 Plasmid Details 3'UTR LMNA lamin A/C Sequence Verified: Yes; 3'UTR length: 1163; Forward Primer: CAGAACTGCAGCATCATGTAA; Reverse Primer: CAATGAGCAGGAGGATGCAGTGA NM_170708 No/No NA P2RP3 bacterial:kanamycin
7 HsCD00730844 Plasmid Details cDNA CFB complement factor B NA BC004143 No/No FUSION pANT7_cGST bacterial:ampicillin
No of Result Per Page : Page: