DNASU Plasmid Repository • 480.965.5697 | Email

Pathways Results

TOP

Pathway : Glucocorticoid biosynthesis, 32 clones found

No of Result Per Page : Page: Explanation of Terms
  DNASU
Plasmid ID
Clone
Type
Gene
Symbol
Gene
Name
Keywords Reference
Sequence
Mutation/
Discrepancy
Insert
Format
Vector Selection
Markers
 
1 HsCD00000717 Plasmid Details cDNA CYP17A1 cytochrome P450, family 17, subfamily A, polypeptide 1 NA NM_000102 No/Yes CLOSED pDNR-Dual bacterial:ampicillin
2 HsCD00000718 Plasmid Details cDNA CYP17A1 cytochrome P450, family 17, subfamily A, polypeptide 1 NA NM_000102 No/Yes CLOSED pDNR-Dual bacterial:ampicillin
3 HsCD00000719 Plasmid Details cDNA CYP17A1 cytochrome P450, family 17, subfamily A, polypeptide 1 NA NM_000102 No/Yes CLOSED pDNR-Dual bacterial:ampicillin
4 HsCD00001543 Plasmid Details cDNA POMC proopiomelanocortin (adrenocorticotropin/ beta-lipotropin/ alpha-melanocyte stimulating hormone/ beta-melanocyte stimulating hormone/ beta-endorphin) NA NM_000939 No/Yes CLOSED pDNR-Dual bacterial:ampicillin
5 HsCD00001726 Plasmid Details cDNA POMC proopiomelanocortin (adrenocorticotropin/ beta-lipotropin/ alpha-melanocyte stimulating hormone/ beta-melanocyte stimulating hormone/ beta-endorphin) NA NM_000939 No/Yes FUSION pDONR201 bacterial:kanamycin
6 HsCD00001727 Plasmid Details cDNA POMC proopiomelanocortin (adrenocorticotropin/ beta-lipotropin/ alpha-melanocyte stimulating hormone/ beta-melanocyte stimulating hormone/ beta-endorphin) NA NM_000939 No/Yes FUSION pDONR201 bacterial:kanamycin
7 HsCD00040028 Plasmid Details cDNA HSD3B1 hydroxy-delta-5-steroid dehydrogenase, 3 beta- and steroid delta-isomerase 1 NA BC031999 No/No FUSION pDONR221 bacterial:kanamycin
8 HsCD00040722 Plasmid Details cDNA HSD3B2 hydroxy-delta-5-steroid dehydrogenase, 3 beta- and steroid delta-isomerase 2 NA BC038419 No/No FUSION pDONR221 bacterial:kanamycin
9 HsCD00043178 Plasmid Details cDNA HSD3B1 hydroxy-delta-5-steroid dehydrogenase, 3 beta- and steroid delta-isomerase 1 NA BC031999 No/No CLOSED pDONR221 bacterial:kanamycin
10 HsCD00043847 Plasmid Details cDNA HSD3B2 hydroxy-delta-5-steroid dehydrogenase, 3 beta- and steroid delta-isomerase 2 NA BC038419 No/No CLOSED pDONR221 bacterial:kanamycin
11 HsCD00044964 Plasmid Details cDNA HSD11B1 hydroxysteroid (11-beta) dehydrogenase 1 NA BC012593 No/No CLOSED pDONR221 bacterial:kanamycin
12 HsCD00075435 Plasmid Details cDNA POMC proopiomelanocortin (adrenocorticotropin/ beta-lipotropin/ alpha-melanocyte stimulating hormone/ beta-melanocyte stimulating hormone/ beta-endorphin) NA NM_000939 No/Yes CLOSED pJP1520 mammalian:puromycin
13 HsCD00075436 Plasmid Details cDNA POMC proopiomelanocortin (adrenocorticotropin/ beta-lipotropin/ alpha-melanocyte stimulating hormone/ beta-melanocyte stimulating hormone/ beta-endorphin) NA NM_000939 No/Yes CLOSED pJP1520 mammalian:puromycin
14 HsCD00076477 Plasmid Details cDNA HSD11B1 hydroxysteroid (11-beta) dehydrogenase 1 NA BC012593 No/No FUSION pDONR221 bacterial:kanamycin
15 HsCD00076980 Plasmid Details cDNA HSD3B2 hydroxy-delta-5-steroid dehydrogenase, 3 beta- and steroid delta-isomerase 2 NA BC038419 No/No FUSION pANT7_cGST bacterial:ampicillin
16 HsCD00082612 Plasmid Details cDNA CYP11B2 cytochrome P450, family 11, subfamily B, polypeptide 2 NA BC111458 No/No FUSION pENTR223.1 bacterial:spectinomycin
17 HsCD00438172 Plasmid Details cDNA HSD3B1 hydroxy-delta-5-steroid dehydrogenase, 3 beta- and steroid delta-isomerase 1 NA No/Yes FUSION pLX304 mammalian:blasticidin
18 HsCD00438470 Plasmid Details cDNA HSD3B2 hydroxy-delta-5-steroid dehydrogenase, 3 beta- and steroid delta-isomerase 2 NA No/No FUSION pLX304 mammalian:blasticidin
19 HsCD00438959 Plasmid Details cDNA CYP17A1 cytochrome P450, family 17, subfamily A, polypeptide 1 NA No/No FUSION pLX304 mammalian:blasticidin
20 HsCD00441123 Plasmid Details cDNA HSD11B1 hydroxysteroid (11-beta) dehydrogenase 1 NA EU176721 No/No FUSION pLX304 mammalian:blasticidin
21 HsCD00443518 Plasmid Details cDNA CYP11B1 cytochrome P450, family 11, subfamily B, polypeptide 1 NA No/No FUSION pLX304 mammalian:blasticidin
22 HsCD00508918 Plasmid Details cDNA HSD11B1 hydroxysteroid (11-beta) dehydrogenase 1 NA EU176721 No/No FUSION pENTR223 bacterial:spectinomycin
23 HsCD00514025 Plasmid Details cDNA CYP11B1 cytochrome P450, family 11, subfamily B, polypeptide 1 NA No/No FUSION pENTR223 bacterial:spectinomycin
24 HsCD00515108 Plasmid Details cDNA POMC proopiomelanocortin NA No/No FUSION pENTR223 bacterial:spectinomycin
25 HsCD00618165 Plasmid Details cDNA CYP17A1 cytochrome P450, family 17, subfamily A, polypeptide 1 NA NM_000102 No/No CLOSED pLDNT7_nFLAG bacterial:chloramphenicol
26 HsCD00622705 Plasmid Details cDNA HSD3B2 "hydroxy-delta-5-steroid dehydrogenase, 3 beta- and steroid delta-isomerase 2" PERFECT_MATCH BC038419.1 No/No FUSION pENTR223 bacterial:spectinomycin
27 HsCD00622880 Plasmid Details cDNA CYP17A1 "cytochrome P450, family 17, subfamily A, polypeptide 1" PERFECT_MATCH BC063388.1 No/No FUSION pENTR223 bacterial:spectinomycin
28 HsCD00640838 Plasmid Details cDNA CYP11B2 cytochrome P450, family 11, subfamily B, polypeptide 2 NA BC111458 No/No FUSION pANT7_cGST bacterial:ampicillin
29 HsUT00699176 Plasmid Details 3'UTR TRSPAP1 tRNA selenocysteine 1 associated protein 1 Sequence Verified: Yes; 3'UTR length: 1089; Forward Primer: TCAGAGATCCCTGCCATGATGTAG; Reverse Primer: ACACTTCCTTTGCAGGACAATCTCTAT NM_017846 No/No NA P2RP3 bacterial:kanamycin
30 HsCD00719279 Plasmid Details cDNA CYP21A2 cytochrome P450, family 21, subfamily A, polypeptide 2 NA BC125181 No/No FUSION pDONR221 bacterial:kanamycin
31 HsCD00730581 Plasmid Details cDNA POMC proopiomelanocortin NA NM_000939 No/No FUSION pANT7_cGST bacterial:ampicillin
32 HsCD00731976 Plasmid Details cDNA HSD3B1 hydroxy-delta-5-steroid dehydrogenase, 3 beta- and steroid delta-isomerase 1 NA BC031999 No/No FUSION pANT7_cGST bacterial:ampicillin
No of Result Per Page : Page: