DNASU Plasmid Repository • 480.965.5697 | Email

Pathways Results


Pathway : Activation of Ca-permeable Kainate Receptor, 47 clones found

No of Result Per Page : Page: Explanation of Terms
Plasmid ID
Keywords Reference
Vector Selection
1 HsCD00001861 Plasmid Details cDNA CALM1 calmodulin 1 (phosphorylase kinase, delta) NA BC000454 No/No CLOSED pDNR-Dual bacterial:ampicillin
2 HsCD00021437 Plasmid Details cDNA DLG3 discs, large homolog 3 (neuroendocrine-dlg, Drosophila) NA NM_021120 No/Yes FUSION pDNR-Dual bacterial:ampicillin
3 HsCD00021438 Plasmid Details cDNA DLG3 discs, large homolog 3 (neuroendocrine-dlg, Drosophila) NA NM_021120 No/Yes FUSION pDNR-Dual bacterial:ampicillin
4 HsCD00038388 Plasmid Details cDNA DLG3 discs, large homolog 3 (neuroendocrine-dlg, Drosophila) NA NM_021120 No/Yes FUSION pJP1520 mammalian:puromycin
5 HsCD00038389 Plasmid Details cDNA DLG3 discs, large homolog 3 (neuroendocrine-dlg, Drosophila) NA NM_021120 No/Yes FUSION pJP1520 mammalian:puromycin
6 HsCD00038533 Plasmid Details cDNA DLG3 discs, large homolog 3 (neuroendocrine-dlg, Drosophila) NA NM_021120 No/Yes FUSION pJP1563 mammalian:blasticidin
7 HsCD00038534 Plasmid Details cDNA DLG3 discs, large homolog 3 (neuroendocrine-dlg, Drosophila) NA NM_021120 No/Yes FUSION pJP1563 mammalian:blasticidin
8 HsCD00038736 Plasmid Details cDNA CALM1 calmodulin 1 (phosphorylase kinase, delta) NA BC000454 No/No FUSION pJP1520 mammalian:puromycin
9 HsCD00038737 Plasmid Details cDNA CALM1 calmodulin 1 (phosphorylase kinase, delta) NA BC000454 No/No CLOSED pJP1520 mammalian:puromycin
10 HsCD00038770 Plasmid Details cDNA CALM1 calmodulin 1 (phosphorylase kinase, delta) NA BC000454 No/No CLOSED pJP1563 mammalian:blasticidin
11 HsCD00074214 Plasmid Details cDNA CALM1 calmodulin 1 (phosphorylase kinase, delta) NA BC000454 No/No CLOSED pJP1520 mammalian:puromycin
12 HsCD00079895 Plasmid Details cDNA NCALD neurocalcin delta NA BC063428 No/No FUSION pDONR221 bacterial:kanamycin
13 HsCD00082246 Plasmid Details cDNA NCALD neurocalcin delta NA BC036098 No/No FUSION pDONR201 bacterial:kanamycin
14 HsCD00082799 Plasmid Details cDNA GRIK3 glutamate receptor, ionotropic, kainate 3 NA NM_000831 No/No CLOSED pENTR223.1 bacterial:spectinomycin
15 HsCD00295568 Plasmid Details cDNA GRIK5 glutamate receptor, ionotropic, kainate 5 NA NM_002088.3 No/No CLOSED pENTR223.1 bacterial:spectinomycin
16 HsCD00297050 Plasmid Details cDNA GRIK1 glutamate receptor, ionotropic, kainate 1 NA NM_175611.2 No/No FUSION pENTR223.1 bacterial:spectinomycin
17 HsCD00297177 Plasmid Details cDNA GRIK3 glutamate receptor, ionotropic, kainate 3 NA NM_000831.2 No/No FUSION pENTR223.1 bacterial:spectinomycin
18 HsCD00299738 Plasmid Details cDNA NCALD neurocalcin delta NA BC063428 No/No FUSION pANT7_cGST bacterial:ampicillin
19 HsCD00329501 Plasmid Details cDNA NCALD neurocalcin delta NA BC063428 No/No FUSION pLenti6.2/V5-DEST mammalian:blasticidin
20 HsCD00350477 Plasmid Details cDNA GRIK3 glutamate receptor, ionotropic, kainate 3 NA BC156721 No/No CLOSED pENTR223.1 bacterial:spectinomycin
21 HsCD00399962 Plasmid Details cDNA GRIK2 glutamate receptor, ionotropic, kainate 2 NA JF432691 No/No FUSION pDONR223 bacterial:spectinomycin
22 HsCD00404922 Plasmid Details cDNA GRIK2 glutamate receptor, ionotropic, kainate 2 NA JF432691 No/No FUSION pANT7_cGST bacterial:ampicillin
23 HsCD00439687 Plasmid Details cDNA GRIK2 glutamate receptor, ionotropic, kainate 2 NA No/Yes FUSION pLX304 mammalian:blasticidin
24 HsCD00440817 Plasmid Details cDNA CALM1 calmodulin 1 (phosphorylase kinase, delta) NA No/Yes FUSION pLX304 mammalian:blasticidin
25 HsCD00441955 Plasmid Details cDNA NCALD neurocalcin delta NA EU446538 No/No FUSION pLX304 mammalian:blasticidin
26 HsCD00444930 Plasmid Details cDNA GRIK2 glutamate receptor, ionotropic, kainate 2 NA JF432691 No/No FUSION pLX304 mammalian:blasticidin
27 HsCD00445699 Plasmid Details cDNA NCALD neurocalcin delta NA EU446538 No/No FUSION pLX304 mammalian:blasticidin
28 HsCD00505282 Plasmid Details cDNA CALM1 calmodulin 1 (phosphorylase kinase, delta) NA No/Yes FUSION pENTR223 bacterial:spectinomycin
29 HsCD00506788 Plasmid Details cDNA NCALD neurocalcin delta NA EU446538 No/No FUSION pENTR223 bacterial:spectinomycin
30 HsCD00507353 Plasmid Details cDNA NCALD neurocalcin delta NA EU446538 No/No FUSION pENTR223 bacterial:spectinomycin
31 HsCD00510375 Plasmid Details cDNA GRIK2 glutamate receptor, ionotropic, kainate 2 NA JF432691 No/No FUSION pENTR223 bacterial:spectinomycin
32 HsCD00516306 Plasmid Details cDNA DLG3 discs, large homolog 3 (Drosophila) NA No/No FUSION pENTR223 bacterial:spectinomycin
33 HsCD00617923 Plasmid Details cDNA DLG3 discs, large homolog 3 (Drosophila) NA NM_021120 No/No CLOSED pLDNT7_nFLAG bacterial:chloramphenicol
34 HsCD00617968 Plasmid Details cDNA CALM1 calmodulin 1 (phosphorylase kinase, delta) NA BC000454 No/No CLOSED pLDNT7_nFLAG bacterial:chloramphenicol
35 HsCD00631095 Plasmid Details cDNA DLG3 discs, large homolog 3 (Drosophila) NA No/No FUSION pANT7_cGST bacterial:ampicillin
36 HsCD00641170 Plasmid Details cDNA GRIK3 glutamate receptor, ionotropic, kainate 3 NA NM_000831 No/No FUSION pANT7_cGST bacterial:ampicillin
37 HsCD00651066 Plasmid Details cDNA DLG3 discs, large homolog 3 (Drosophila) targeted domain No/No CLOSED pET15_NESG bacterial:ampicillin
38 HsCD00651067 Plasmid Details cDNA DLG3 discs, large homolog 3 (Drosophila) targeted domain No/Yes CLOSED pET15_NESG bacterial:ampicillin
39 HsCD00651068 Plasmid Details cDNA DLG3 discs, large homolog 3 (Drosophila) targeted domain No/No CLOSED pET15_NESG bacterial:ampicillin
40 HsCD00651069 Plasmid Details cDNA DLG3 discs, large homolog 3 (Drosophila) targeted domain No/No CLOSED pET15_NESG bacterial:ampicillin
41 HsCD00651070 Plasmid Details cDNA DLG3 discs, large homolog 3 (Drosophila) targeted domain No/No CLOSED pET15_NESG bacterial:ampicillin
42 HsCD00651071 Plasmid Details cDNA DLG3 discs, large homolog 3 (Drosophila) targeted domain No/No CLOSED pET15_NESG bacterial:ampicillin
43 HsUT00698844 Plasmid Details 3'UTR USF1 upstream transcription factor 1 Sequence Verified: Yes; 3'UTR length: 849; Forward Primer: GTCATCAAGAATGACAGCAACTAA; Reverse Primer: CACACCGGTCTGGCCCAG NM_207005 No/No NA P2RP3 bacterial:kanamycin
44 HsCD00719278 Plasmid Details cDNA GRIK4 glutamate receptor, ionotropic, kainate 4 NA BC150173 No/No FUSION pDONR221 bacterial:kanamycin
45 HsCD00746053 Plasmid Details cDNA DLG3 discs, large homolog 3 (Drosophila) NA NM_021120 No/No FUSION pDONR221 bacterial:kanamycin
46 HsCD00821558 Plasmid Details cDNA GRIK2 glutamate ionotropic receptor kainate type subunit 2 Codon optimized NM_021956 Yes/No FUSION pDONR221 bacterial:kanamycin
47 HsCD00821748 Plasmid Details cDNA DLG4 discs large MAGUK scaffold protein 4 Codon optimized NM_001365 Yes/No FUSION pDONR221 bacterial:kanamycin
No of Result Per Page : Page: