DNASU Plasmid Repository • 480.965.5697 | Email

Pathways Results


Pathway : Heme degradation, 45 clones found

No of Result Per Page : Page: Explanation of Terms
Plasmid ID
Keywords Reference
Vector Selection
1 HsCD00000846 Plasmid Details cDNA HMOX2 heme oxygenase (decycling) 2 NA NM_002134 No/No FUSION pDNR-Dual bacterial:ampicillin
2 HsCD00000847 Plasmid Details cDNA HMOX2 heme oxygenase (decycling) 2 NA NM_002134 No/Yes FUSION pDNR-Dual bacterial:ampicillin
3 HsCD00000848 Plasmid Details cDNA HMOX2 heme oxygenase (decycling) 2 NA NM_002134 No/Yes CLOSED pDNR-Dual bacterial:ampicillin
4 HsCD00000849 Plasmid Details cDNA HMOX2 heme oxygenase (decycling) 2 NA NM_002134 No/Yes CLOSED pDNR-Dual bacterial:ampicillin
5 HsCD00000850 Plasmid Details cDNA HMOX1 heme oxygenase (decycling) 1 NA NM_002133 No/No FUSION pDONR201 bacterial:kanamycin
6 HsCD00000851 Plasmid Details cDNA HMOX1 heme oxygenase (decycling) 1 NA NM_002133 No/Yes CLOSED pDNR-Dual bacterial:ampicillin
7 HsCD00000852 Plasmid Details cDNA HMOX1 heme oxygenase (decycling) 1 NA NM_002133 No/No FUSION pDNR-Dual bacterial:ampicillin
8 HsCD00005382 Plasmid Details cDNA HMOX2 heme oxygenase (decycling) 2 NA BC002396 No/Yes FUSION pDONR201 bacterial:kanamycin
9 HsCD00041260 Plasmid Details cDNA HMOX1 heme oxygenase (decycling) 1 NA BC001491 No/No FUSION pDONR221 bacterial:kanamycin
10 HsCD00044373 Plasmid Details cDNA HMOX1 heme oxygenase (decycling) 1 NA BC001491 No/No CLOSED pDONR221 bacterial:kanamycin
11 HsCD00073800 Plasmid Details cDNA HMOX1 heme oxygenase (decycling) 1 NA CR456505 No/No FUSION pENTR223 bacterial:spectinomycin
12 HsCD00073894 Plasmid Details cDNA HMOX1 heme oxygenase (decycling) 1 NA CR456505 No/No CLOSED pENTR223 bacterial:spectinomycin
13 HsCD00295640 Plasmid Details cDNA HMOX2 heme oxygenase (decycling) 2 NA BC002396.2 No/No CLOSED pDONR221 bacterial:kanamycin
14 HsCD00295730 Plasmid Details cDNA HMOX2 heme oxygenase (decycling) 2 NA BC002396.2 No/No FUSION pDONR221 bacterial:kanamycin
15 HsCD00301263 Plasmid Details cDNA HMOX1 heme oxygenase (decycling) 1 NA CR456505 No/No FUSION pANT7_cGST bacterial:ampicillin
16 HsCD00301521 Plasmid Details cDNA HMOX1 heme oxygenase (decycling) 1 NA NM_002133 No/No FUSION pANT7_cGST bacterial:ampicillin
17 HsCD00350917 Plasmid Details cDNA HMOX1 heme oxygenase (decycling) 1 NA CU013391 No/No FUSION pENTR223 bacterial:spectinomycin
18 HsCD00351013 Plasmid Details cDNA HMOX1 heme oxygenase (decycling) 1 NA CU013103 No/No CLOSED pENTR223 bacterial:spectinomycin
19 HsCD00358270 Plasmid Details cDNA UGT1A1 UDP glucuronosyltransferase 1 family, polypeptide A1 partial cds (N and C terminal deletion) BC128414 Yes/No CLOSED pDONR221 bacterial:kanamycin
20 HsCD00402672 Plasmid Details cDNA HMOX1 heme oxygenase (decycling) 1 NA CU013391 No/No FUSION pANT7_cGST bacterial:ampicillin
21 HsCD00413113 Plasmid Details cDNA UGT1A1 UDP glucuronosyltransferase 1 family, polypeptide A1 partial cds (N and C terminal deletion) BC128414 Yes/No CLOSED pGEn2-DEST bacterial:ampicillin
22 HsCD00413294 Plasmid Details cDNA UGT1A1 UDP glucuronosyltransferase 1 family, polypeptide A1 partial cds (N and C terminal deletion) BC128414 Yes/No CLOSED pGEn1-DEST bacterial:ampicillin
23 HsCD00413724 Plasmid Details cDNA UGT1A1 UDP glucuronosyltransferase 1 family, polypeptide A1 NA BC128414 No/No FUSION pGEc1-DEST bacterial:ampicillin
24 HsCD00434958 Plasmid Details cDNA HMOX1 heme oxygenase (decycling) 1 NA DQ895510 No/No FUSION pLX304 mammalian:blasticidin
25 HsCD00440263 Plasmid Details cDNA UGT1A1 UDP glucuronosyltransferase 1 family, polypeptide A1 NA No/No FUSION pLX304 mammalian:blasticidin
26 HsCD00441127 Plasmid Details cDNA BLVRA biliverdin reductase A NA No/No FUSION pLX304 mammalian:blasticidin
27 HsCD00443783 Plasmid Details cDNA BLVRA biliverdin reductase A NA No/No FUSION pLX304 mammalian:blasticidin
28 HsCD00444043 Plasmid Details cDNA HMOX2 heme oxygenase (decycling) 2 NA EU831544 No/No FUSION pLX304 mammalian:blasticidin
29 HsCD00451144 Plasmid Details cDNA UGT1A1 UDP glucuronosyltransferase 1 family, polypeptide A1 NA BC128414 No/No FUSION pDONR221 bacterial:kanamycin
30 HsCD00508824 Plasmid Details cDNA HMOX1 heme oxygenase (decycling) 1 NA DQ895510 No/No FUSION pENTR223 bacterial:spectinomycin
31 HsCD00508996 Plasmid Details cDNA BLVRA biliverdin reductase A NA No/No FUSION pENTR223 bacterial:spectinomycin
32 HsCD00509025 Plasmid Details cDNA BLVRA biliverdin reductase A NA No/No FUSION pENTR223 bacterial:spectinomycin
33 HsCD00509250 Plasmid Details cDNA HMOX2 heme oxygenase (decycling) 2 NA EU831544 No/No FUSION pENTR223 bacterial:spectinomycin
34 HsCD00513247 Plasmid Details cDNA UGT1A1 UDP glucuronosyltransferase 1 family, polypeptide A1 NA No/No FUSION pENTR223 bacterial:spectinomycin
35 HsCD00521192 Plasmid Details cDNA UGT1A1 UDP glucuronosyltransferase 1 family, polypeptide A1 partial cds (C-terminal deletion) BC128414 No/No FUSION pGEc2-DEST bacterial:ampicillin
36 HsCD00522437 Plasmid Details cDNA UGT1A1 UDP glucuronosyltransferase 1 family, polypeptide A1 partial cds BC128414 Yes/No CLOSED pGEn3-DEST bacterial:ampicillin
37 HsCD00630772 Plasmid Details cDNA BLVRA biliverdin reductase A NA No/No FUSION pANT7_cGST bacterial:ampicillin
38 HsCD00639415 Plasmid Details cDNA UGT1A1 UDP glucuronosyltransferase 1 family, polypeptide A1 NA BC128414 No/No FUSION pANT7_cGST bacterial:ampicillin
39 HsCD00640661 Plasmid Details cDNA UGT1A1 UDP glucuronosyltransferase 1 family, polypeptide A1 NA NM_000463 No/No FUSION pANT7_cGST bacterial:ampicillin
40 HsCD00651408 Plasmid Details cDNA HMOX2 heme oxygenase (decycling) 2 targeted domain No/No CLOSED pET15Nano6HT_NESG bacterial:ampicillin
41 HsUT00698088 Plasmid Details 3'UTR ZNF281 zinc finger protein 281 Sequence Verified: Yes; 3'UTR length: 906; Forward Primer: ACCAGCCAGAGTTACAGGTAA; Reverse Primer: TCAGTTAATCATATAATTTCAACTTGAGTT NM_012482 No/No NA P2RP3 bacterial:kanamycin
42 HsCD00730585 Plasmid Details cDNA HMOX2 heme oxygenase 2 NA BC002396 No/No FUSION pANT7_cGST bacterial:ampicillin
43 HsCD00730849 Plasmid Details cDNA HMOX1 heme oxygenase 1 NA BC001491 No/No FUSION pANT7_cGST bacterial:ampicillin
44 HsCD00785010 Plasmid Details cDNA HMOX2 heme oxygenase 2 NA NM_001286267 Yes/No FUSION pANT7_cGST bacterial:ampicillin
45 HsCD00813218 Plasmid Details cDNA HMOX2 heme oxygenase 2 Gene synthesis by Gen9. Codon optimized NM_001286267 No/No FUSION pDONR221 bacterial:kanamycin
No of Result Per Page : Page: