DNASU Plasmid Repository • 480.965.5697 | Email

Pathways Results

TOP

Pathway : Histidine catabolism, 13 clones found

No of Result Per Page : Page: Explanation of Terms
  DNASU
Plasmid ID
Clone
Type
Gene
Symbol
Gene
Name
Keywords Reference
Sequence
Mutation/
Discrepancy
Insert
Format
Vector Selection
Markers
 
1 HsCD00353793 Plasmid Details cDNA HDC histidine decarboxylase NA HQ258478 No/No FUSION pDONR223 bacterial:spectinomycin
2 HsCD00403529 Plasmid Details cDNA HDC histidine decarboxylase NA HQ258478 No/No FUSION pANT7_cGST bacterial:ampicillin
3 HsCD00441605 Plasmid Details cDNA AMDHD1 amidohydrolase domain containing 1 NA JF432709 No/No FUSION pLX304 mammalian:blasticidin
4 HsCD00443567 Plasmid Details cDNA HAL histidine ammonia-lyase NA No/No FUSION pLX304 mammalian:blasticidin
5 HsCD00446499 Plasmid Details cDNA HDC histidine decarboxylase NA HQ258478 No/No FUSION pLX304 mammalian:blasticidin
6 HsCD00505404 Plasmid Details cDNA HAL histidine ammonia-lyase NA No/No FUSION pENTR223 bacterial:spectinomycin
7 HsCD00511853 Plasmid Details cDNA AMDHD1 amidohydrolase domain containing 1 NA JF432709 No/No FUSION pENTR223 bacterial:spectinomycin
8 HsCD00514409 Plasmid Details cDNA HDC histidine decarboxylase NA HQ258478 No/No FUSION pENTR223 bacterial:spectinomycin
9 HsCD00631128 Plasmid Details cDNA AMDHD1 amidohydrolase domain containing 1 NA No/No FUSION pANT7_cGST bacterial:ampicillin
10 HsCD00641425 Plasmid Details cDNA HAL histidine ammonia-lyase NA NM_002108 No/No FUSION pANT7_cGST bacterial:ampicillin
11 HsUT00699243 Plasmid Details 3'UTR SCYL3 SCY1-like 3 (S. cerevisiae) Sequence Verified: Yes; 3'UTR length: 819; Forward Primer: GAGCTGAACTGGGAAGATAATAACTGGTGA; Reverse Primer: TGGAAATGGAGGCGCTCCAA NM_181093 No/No NA P2RP3 bacterial:kanamycin
12 HsCD00719268 Plasmid Details cDNA FTCD formimidoyltransferase cyclodeaminase NA BC136395 No/No FUSION pDONR221 bacterial:kanamycin
13 HsCD00813287 Plasmid Details cDNA UROC1 urocanate hydratase 1 Source: Gene synthesis by Gen9; codon optimized NM_001165974 No/No FUSION pDONR221 bacterial:kanamycin
No of Result Per Page : Page: