DNASU Plasmid Repository • 480.965.5697 | Email

Pathways Results


Pathway : Klotho-mediated ligand binding, 43 clones found

No of Result Per Page : Page: Explanation of Terms
Plasmid ID
Keywords Reference
Vector Selection
1 HsCD00002202 Plasmid Details cDNA FGF19 fibroblast growth factor 19 NA BC017664 No/No FUSION pDNR-Dual bacterial:ampicillin
2 HsCD00002203 Plasmid Details cDNA FGF19 fibroblast growth factor 19 NA BC017664 No/No CLOSED pDNR-Dual bacterial:ampicillin
3 HsCD00002204 Plasmid Details cDNA FGF19 fibroblast growth factor 19 NA BC017664 No/No CLOSED pDNR-Dual bacterial:ampicillin
4 HsCD00005170 Plasmid Details cDNA FGFR4 fibroblast growth factor receptor 4 NA BC011847 No/No FUSION pDNR-Dual bacterial:ampicillin
5 HsCD00005171 Plasmid Details cDNA FGFR4 fibroblast growth factor receptor 4 NA BC011847 No/No CLOSED pDNR-Dual bacterial:ampicillin
6 HsCD00005907 Plasmid Details cDNA FGFR1 fibroblast growth factor receptor 1 (fms-related tyrosine kinase 2, Pfeiffer syndrome) NA BC018128 No/No FUSION pDNR-Dual bacterial:ampicillin
7 HsCD00038214 Plasmid Details cDNA FGFR1 fibroblast growth factor receptor 1 (fms-related tyrosine kinase 2, Pfeiffer syndrome) NA BC018128 No/No FUSION pJP1520 mammalian:puromycin
8 HsCD00038218 Plasmid Details cDNA FGFR4 fibroblast growth factor receptor 4 NA BC011847 No/No FUSION pJP1520 mammalian:puromycin
9 HsCD00038229 Plasmid Details cDNA FGFR4 fibroblast growth factor receptor 4 NA BC011847 No/No CLOSED pJP1520 mammalian:puromycin
10 HsCD00038950 Plasmid Details cDNA FGFR1 fibroblast growth factor receptor 1 (fms-related tyrosine kinase 2, Pfeiffer syndrome) NA BC018128 No/No FUSION pJP1563 mammalian:blasticidin
11 HsCD00038953 Plasmid Details cDNA FGFR4 fibroblast growth factor receptor 4 NA BC011847 No/No FUSION pJP1563 mammalian:blasticidin
12 HsCD00039179 Plasmid Details cDNA FGFR4 fibroblast growth factor receptor 4 NA BC011847 No/No CLOSED pJP1563 mammalian:blasticidin
13 HsCD00040773 Plasmid Details cDNA FGFR1 fibroblast growth factor receptor 1 (fms-related tyrosine kinase 2, Pfeiffer syndrome) NA BC018128 No/No FUSION pDONR221 bacterial:kanamycin
14 HsCD00042060 Plasmid Details cDNA FGFR4 fibroblast growth factor receptor 4 NA BC011847 No/No FUSION pDONR221 bacterial:kanamycin
15 HsCD00045475 Plasmid Details cDNA FGFR4 fibroblast growth factor receptor 4 NA BC011847 No/No CLOSED pDONR221 bacterial:kanamycin
16 HsCD00074433 Plasmid Details cDNA FGF19 fibroblast growth factor 19 NA BC017664 No/No CLOSED pJP1520 mammalian:puromycin
17 HsCD00074434 Plasmid Details cDNA FGF19 fibroblast growth factor 19 NA BC017664 No/No CLOSED pJP1520 mammalian:puromycin
18 HsCD00074999 Plasmid Details cDNA FGFR4 fibroblast growth factor receptor 4 NA BC011847 No/No CLOSED pJP1520 mammalian:puromycin
19 HsCD00358182 Plasmid Details cDNA FGFR4 fibroblast growth factor receptor 4 NA BC011847 No/No CLOSED pMCSG19 bacterial:ampicillin
20 HsCD00358198 Plasmid Details cDNA FGFR1 fibroblast growth factor receptor 1 NA BC018128 No/No FUSION pMCSG7 bacterial:ampicillin
21 HsCD00358424 Plasmid Details cDNA KLB klotho beta partial cds (N and C terminal deletion) BC104871 Yes/No CLOSED pDONR221 bacterial:kanamycin
22 HsCD00399633 Plasmid Details cDNA FGF19 fibroblast growth factor 19 NA JF432499 No/No FUSION pDONR223 bacterial:spectinomycin
23 HsCD00404643 Plasmid Details cDNA FGF19 fibroblast growth factor 19 NA JF432499 No/No FUSION pANT7_cGST bacterial:ampicillin
24 HsCD00413199 Plasmid Details cDNA KLB klotho beta partial cds (N and C terminal deletion) BC104871 Yes/No CLOSED pGEn2-DEST bacterial:ampicillin
25 HsCD00413386 Plasmid Details cDNA KLB klotho beta partial cds (N and C terminal deletion) BC104871 Yes/No CLOSED pGEn1-DEST bacterial:ampicillin
26 HsCD00434504 Plasmid Details cDNA FGF19 fibroblast growth factor 19 NA JF432499 No/No FUSION pLX304 mammalian:blasticidin
27 HsCD00438789 Plasmid Details cDNA FGFR1 fibroblast growth factor receptor 1 NA No/No FUSION pLX304 mammalian:blasticidin
28 HsCD00507020 Plasmid Details cDNA FGF19 fibroblast growth factor 19 NA JF432499 No/No FUSION pENTR223 bacterial:spectinomycin
29 HsCD00522527 Plasmid Details cDNA KLB klotho beta partial cds (N and C terminal deletion) BC104871 Yes/No CLOSED pGEn3-DEST bacterial:ampicillin
30 HsCD00618037 Plasmid Details cDNA FGFR1 fibroblast growth factor receptor 1 NA BC018128 No/No CLOSED pLDNT7_nFLAG bacterial:chloramphenicol
31 HsCD00618049 Plasmid Details cDNA FGFR4 fibroblast growth factor receptor 4 NA BC011847 No/No CLOSED pLDNT7_nFLAG bacterial:chloramphenicol
32 HsCD00623062 Plasmid Details cDNA FGFR1 fibroblast growth factor receptor 1 PERFECT_MATCH BC015035.1 No/No FUSION pENTR223 bacterial:spectinomycin
33 HsCD00674492 Plasmid Details cDNA FGF23 fibroblast growth factor 23 NA BC096713 No/No FUSION pANT7_cGST bacterial:ampicillin
34 HsUT00698114 Plasmid Details 3'UTR WDR77 WD repeat domain 77 Sequence Verified: Yes; 3'UTR length: 1520; Forward Primer: CCTGCAAGTGTTACTGAGTAG; Reverse Primer: TTACTTTCTCTAAGTGTCCACAAAATTAAA NM_024102 No/No NA P2RP3 bacterial:kanamycin
35 HsCD00718543 Plasmid Details cDNA FGF23 fibroblast growth factor 23 NA BC096713 No/No FUSION pDONR221 bacterial:kanamycin
36 HsCD00719358 Plasmid Details cDNA FGF23 fibroblast growth factor 23 NA BC098147 No/No FUSION pDONR221 bacterial:kanamycin
37 HsCD00730704 Plasmid Details cDNA FGFR1 fibroblast growth factor receptor 1 NA BC018128 No/No FUSION pANT7_cGST bacterial:ampicillin
38 HsCD00730731 Plasmid Details cDNA FGFR4 fibroblast growth factor receptor 4 NA BC011847 No/No FUSION pANT7_cGST bacterial:ampicillin
39 HsCD00744419 Plasmid Details cDNA FGFR4 fibroblast growth factor receptor 4 NA BC011847.1 No/No FUSION pDONR221 bacterial:kanamycin
40 HsCD00744448 Plasmid Details cDNA FGFR1 fibroblast growth factor receptor 1 NA BC018128.1 No/No FUSION pDONR221 bacterial:kanamycin
41 HsCD00745523 Plasmid Details cDNA KLB klotho beta NA BC104871 No/No FUSION pDONR221 bacterial:kanamycin
42 HsCD00746477 Plasmid Details cDNA KLB klotho beta NA BC113653 No/No FUSION pDONR221 bacterial:kanamycin
43 HsCD00817424 Plasmid Details cDNA FGFR1 fibroblast growth factor receptor 1 "insert_ID 27466,DNASU_Clone_ID HsCD00040773" BC018128 No/No FUSION pJFT7_nHalo_DC(r4) bacterial:ampicillin
No of Result Per Page : Page: