DNASU Plasmid Repository • 480.965.5697 | Email

Pathways Results

TOP

Pathway : LDL-mediated lipid transport, 22 clones found

No of Result Per Page : Page: Explanation of Terms
  DNASU
Plasmid ID
Clone
Type
Gene
Symbol
Gene
Name
Keywords Reference
Sequence
Mutation/
Discrepancy
Insert
Format
Vector Selection
Markers
 
1 HsCD00004643 Plasmid Details cDNA LDLR low density lipoprotein receptor (familial hypercholesterolemia) NA BC014514 No/No FUSION pDNR-Dual bacterial:ampicillin
2 HsCD00004644 Plasmid Details cDNA LDLR low density lipoprotein receptor (familial hypercholesterolemia) NA BC014514 No/No CLOSED pDNR-Dual bacterial:ampicillin
3 HsCD00021891 Plasmid Details cDNA CETP cholesteryl ester transfer protein, plasma NA NM_000078 No/Yes CLOSED pDNR-Dual bacterial:ampicillin
4 HsCD00039565 Plasmid Details cDNA LDLR low density lipoprotein receptor (familial hypercholesterolemia) NA BC014514 No/No FUSION pDONR221 bacterial:kanamycin
5 HsCD00074209 Plasmid Details cDNA LDLR low density lipoprotein receptor (familial hypercholesterolemia) NA BC014514 No/No CLOSED pJP1520 mammalian:puromycin
6 HsCD00075938 Plasmid Details cDNA CETP cholesteryl ester transfer protein, plasma NA BC025739 No/Yes FUSION pDONR221 bacterial:kanamycin
7 HsCD00076802 Plasmid Details cDNA LDLR low density lipoprotein receptor (familial hypercholesterolemia) NA BC014514 No/No FUSION pANT7_cGST bacterial:ampicillin
8 HsCD00288176 Plasmid Details cDNA APOF apolipoprotein F NA BC026257.1 No/No FUSION pENTR223 bacterial:spectinomycin
9 HsCD00303549 Plasmid Details cDNA APOF apolipoprotein F NA BC026257.1 No/No FUSION pANT7_cGST bacterial:ampicillin
10 HsCD00352705 Plasmid Details cDNA APOF apolipoprotein F NA HQ447649 No/No FUSION pDONR223 bacterial:spectinomycin
11 HsCD00357879 Plasmid Details cDNA APOF apolipoprotein F NA HQ447649 No/No FUSION pANT7_cGST bacterial:ampicillin
12 HsCD00383987 Plasmid Details cDNA LDLRAP1 low density lipoprotein receptor adaptor protein 1 full-length cds AL117654 No/Yes CLOSED pDONR221 bacterial:kanamycin
13 HsCD00424439 Plasmid Details cDNA LDLRAP1 low density lipoprotein receptor adaptor protein 1 full-length cds AL117654 No/No CLOSED pVP56K bacterial:kanamycin
14 HsCD00434227 Plasmid Details cDNA CETP cholesteryl ester transfer protein, plasma NA EU176529 No/No FUSION pLX304 mammalian:blasticidin
15 HsCD00439230 Plasmid Details cDNA APOF apolipoprotein F NA HQ447649 No/No FUSION pLX304 mammalian:blasticidin
16 HsCD00442342 Plasmid Details cDNA LDLRAP1 low density lipoprotein receptor adaptor protein 1 NA No/No FUSION pLX304 mammalian:blasticidin
17 HsCD00508152 Plasmid Details cDNA LDLRAP1 low density lipoprotein receptor adaptor protein 1 NA No/No FUSION pENTR223 bacterial:spectinomycin
18 HsCD00509942 Plasmid Details cDNA APOF apolipoprotein F NA HQ447649 No/No FUSION pENTR223 bacterial:spectinomycin
19 HsCD00512364 Plasmid Details cDNA CETP cholesteryl ester transfer protein, plasma NA EU176529 No/No FUSION pENTR223 bacterial:spectinomycin
20 HsCD00639329 Plasmid Details cDNA LDLRAP1 low density lipoprotein receptor adaptor protein 1 NA No/No FUSION pANT7_cGST bacterial:ampicillin
21 HsUT00699483 Plasmid Details 3'UTR TFAP2E transcription factor AP-2 epsilon (activating enhancer binding protein 2 epsilon) Sequence Verified: Yes; 3'UTR length: 830; Forward Primer: AAGGATGCCAAGCATCGGAAATAA; Reverse Primer: CACACCTTTCTTCCCTCCCAAC NM_178548 No/No NA P2RP3 bacterial:kanamycin
22 HsCD00731989 Plasmid Details cDNA CETP cholesteryl ester transfer protein, plasma NA BC025739 No/No FUSION pANT7_cGST bacterial:ampicillin
No of Result Per Page : Page: