DNASU Plasmid Repository • 480.965.5697 | Email

Pathways Results

TOP

Pathway : Laminin interactions, 41 clones found

No of Result Per Page : Page: Explanation of Terms
  DNASU
Plasmid ID
Clone
Type
Gene
Symbol
Gene
Name
Keywords Reference
Sequence
Mutation/
Discrepancy
Insert
Format
Vector Selection
Markers
 
1 HsCD00000203 Plasmid Details cDNA ITGB1 integrin, beta 1 (fibronectin receptor, beta polypeptide, antigen CD29 includes MDF2, MSK12) NA BC009469 No/No FUSION pDONR201 bacterial:kanamycin
2 HsCD00000204 Plasmid Details cDNA ITGB1 integrin, beta 1 (fibronectin receptor, beta polypeptide, antigen CD29 includes MDF2, MSK12) NA BC009469 No/No CLOSED pDONR201 bacterial:kanamycin
3 HsCD00000205 Plasmid Details cDNA ITGB1 integrin, beta 1 (fibronectin receptor, beta polypeptide, antigen CD29 includes MDF2, MSK12) NA BC009469 No/No FUSION pDNR-Dual bacterial:ampicillin
4 HsCD00000206 Plasmid Details cDNA ITGB1 integrin, beta 1 (fibronectin receptor, beta polypeptide, antigen CD29 includes MDF2, MSK12) NA BC009469 No/No CLOSED pDNR-Dual bacterial:ampicillin
5 HsCD00022037 Plasmid Details cDNA LAMA5 laminin, alpha 5 potential short variant BC003355 No/No FUSION pDNR-Dual bacterial:ampicillin
6 HsCD00022185 Plasmid Details cDNA LAMA4 laminin, alpha 4 potential short variant BC004241 No/Yes FUSION pDNR-Dual bacterial:ampicillin
7 HsCD00022186 Plasmid Details cDNA LAMA4 laminin, alpha 4 potential short variant BC004241 No/No FUSION pDNR-Dual bacterial:ampicillin
8 HsCD00022187 Plasmid Details cDNA LAMA4 laminin, alpha 4 potential short variant BC004241 No/No CLOSED pDNR-Dual bacterial:ampicillin
9 HsCD00039937 Plasmid Details cDNA ITGB1 integrin, beta 1 (fibronectin receptor, beta polypeptide, antigen CD29 includes MDF2, MSK12) NA BC020057 No/No FUSION pDONR221 bacterial:kanamycin
10 HsCD00043086 Plasmid Details cDNA ITGB1 integrin, beta 1 (fibronectin receptor, beta polypeptide, antigen CD29 includes MDF2, MSK12) NA BC020057 No/No CLOSED pDONR221 bacterial:kanamycin
11 HsCD00074881 Plasmid Details cDNA ITGB1 integrin, beta 1 (fibronectin receptor, beta polypeptide, antigen CD29 includes MDF2, MSK12) NA BC009469 No/No CLOSED pJP1520 mammalian:puromycin
12 HsCD00074995 Plasmid Details cDNA ITGB1 integrin, beta 1 (fibronectin receptor, beta polypeptide, antigen CD29 includes MDF2, MSK12) NA BC009469 No/No CLOSED pJP1520 mammalian:puromycin
13 HsCD00081484 Plasmid Details cDNA ITGB1 integrin, beta 1 (fibronectin receptor, beta polypeptide, antigen CD29 includes MDF2, MSK12) NA BX537407 No/Yes FUSION pDONR201 bacterial:kanamycin
14 HsCD00082858 Plasmid Details cDNA LAMC3 laminin, gamma 3 NA NM_006059 No/No FUSION pENTR223.1 bacterial:spectinomycin
15 HsCD00295582 Plasmid Details cDNA LAMB3 laminin, beta 3 NA BC075838.1 No/No CLOSED pDONR221 bacterial:kanamycin
16 HsCD00295674 Plasmid Details cDNA LAMB3 laminin, beta 3 NA BC075838.1 No/No FUSION pDONR221 bacterial:kanamycin
17 HsCD00302540 Plasmid Details cDNA ITGA2 integrin, alpha 2 (CD49B, alpha 2 subunit of VLA-2 receptor) NA NM_002203 No/No FUSION pANT7_cGST bacterial:ampicillin
18 HsCD00305036 Plasmid Details cDNA ITGB1 integrin, beta 1 (fibronectin receptor, beta polypeptide, antigen CD29 includes MDF2, MSK12) NA BC009469.1 Unknown/Unknown FUSION pDONR201 bacterial:kanamycin
19 HsCD00350644 Plasmid Details cDNA LAMC3 laminin, gamma 3 NA BC156274 No/No FUSION pENTR223.1 bacterial:spectinomycin
20 HsCD00351386 Plasmid Details cDNA ITGA2 integrin, alpha 2 (CD49B, alpha 2 subunit of VLA-2 receptor) NA BC148596 No/No FUSION pENTR223.1 bacterial:spectinomycin
21 HsCD00353992 Plasmid Details cDNA LAMA2 laminin, alpha 2 NA BC172564 No/No CLOSED pENTR223.1 bacterial:spectinomycin
22 HsCD00356545 Plasmid Details cDNA ITGA2 integrin, alpha 2 (CD49B, alpha 2 subunit of VLA-2 receptor) NA BC148596 No/No FUSION pANT7_cGST bacterial:ampicillin
23 HsCD00399186 Plasmid Details cDNA LAMA3 laminin, alpha 3 NA BC172402 No/No CLOSED pENTR223.1 bacterial:spectinomycin
24 HsCD00399373 Plasmid Details cDNA NID1 nidogen 1 NA BC045606 No/No FUSION pDONR223 bacterial:spectinomycin
25 HsCD00399894 Plasmid Details cDNA LAMA4 laminin, alpha 4 NA JF432726 No/No FUSION pDONR223 bacterial:spectinomycin
26 HsCD00403001 Plasmid Details cDNA LAMC3 laminin, gamma 3 NA BC156274 No/No FUSION pANT7_cGST bacterial:ampicillin
27 HsCD00404436 Plasmid Details cDNA NID1 nidogen 1 NA BC045606 No/No FUSION pANT7_cGST bacterial:ampicillin
28 HsCD00404872 Plasmid Details cDNA LAMA4 laminin, alpha 4 NA JF432726 No/No FUSION pANT7_cGST bacterial:ampicillin
29 HsCD00434304 Plasmid Details cDNA NID2 nidogen 2 (osteonidogen) NA No/No FUSION pLX304 mammalian:blasticidin
30 HsCD00438718 Plasmid Details cDNA LAMA4 laminin, alpha 4 NA JF432726 No/No FUSION pLX304 mammalian:blasticidin
31 HsCD00442171 Plasmid Details cDNA LAMC1 laminin, gamma 1 (formerly LAMB2) NA No/No FUSION pLX304 mammalian:blasticidin
32 HsCD00504245 Plasmid Details cDNA LAMC1 laminin, gamma 1 (formerly LAMB2) NA No/No FUSION pENTR223 bacterial:spectinomycin
33 HsCD00504867 Plasmid Details cDNA LAMA4 laminin, alpha 4 NA JF432726 No/No FUSION pENTR223 bacterial:spectinomycin
34 HsCD00505895 Plasmid Details cDNA NID2 nidogen 2 (osteonidogen) NA No/No FUSION pENTR223 bacterial:spectinomycin
35 HsCD00516505 Plasmid Details cDNA ITGA6 integrin, alpha 6 NA No/No FUSION pENTR223 bacterial:spectinomycin
36 HsCD00641199 Plasmid Details cDNA LAMB3 laminin, beta 3 NA BC075838 No/No FUSION pANT7_cGST bacterial:ampicillin
37 HsUT00698866 Plasmid Details 3'UTR BCL11A B-cell CLL/lymphoma 11A (zinc finger protein) Sequence Verified: Yes; 3'UTR length: 1588; Forward Primer: TCGAGAGCCCTTAAGTTCTGA; Reverse Primer: TCTCTTACTGATGTGGCCTCTGG NM_018014 No/No NA P2RP3 bacterial:kanamycin
38 HsCD00731286 Plasmid Details cDNA ITGB1 integrin, beta 1 (fibronectin receptor, beta polypeptide, antigen CD29 includes MDF2, MSK12) NA BC020057 No/No FUSION pANT7_cGST bacterial:ampicillin
39 HsCD00731686 Plasmid Details cDNA LAMC3 laminin, gamma 3 NA NM_006059 No/No FUSION pANT7_cGST bacterial:ampicillin
40 HsCD00734647 Plasmid Details cDNA ITGA6 integrin, alpha 6 NA NM_001079818 No/No FUSION pANT7_cGST bacterial:ampicillin
41 HsCD00734740 Plasmid Details cDNA NID2 nidogen 2 (osteonidogen) NA No/No FUSION pANT7_cGST bacterial:ampicillin
No of Result Per Page : Page: