DNASU Plasmid Repository • 480.965.5697 | Email

Pathways Results


Pathway : Linoleic acid (LA) metabolism, 31 clones found

No of Result Per Page : Page: Explanation of Terms
Plasmid ID
Keywords Reference
Vector Selection
1 HsCD00004034 Plasmid Details cDNA FADS1 fatty acid desaturase 1 NA BC007846 No/No FUSION pDNR-Dual bacterial:ampicillin
2 HsCD00004035 Plasmid Details cDNA FADS1 fatty acid desaturase 1 NA BC007846 No/No CLOSED pDNR-Dual bacterial:ampicillin
3 HsCD00039508 Plasmid Details cDNA FADS1 fatty acid desaturase 1 NA BC007846 No/No FUSION pDONR221 bacterial:kanamycin
4 HsCD00039863 Plasmid Details cDNA ABCD1 ATP-binding cassette, sub-family D (ALD), member 1 NA BC015541 No/No FUSION pDONR221 bacterial:kanamycin
5 HsCD00042660 Plasmid Details cDNA FADS1 fatty acid desaturase 1 NA BC007846 No/No CLOSED pDONR221 bacterial:kanamycin
6 HsCD00043017 Plasmid Details cDNA ABCD1 ATP-binding cassette, sub-family D (ALD), member 1 NA BC015541 No/Yes CLOSED pDONR221 bacterial:kanamycin
7 HsCD00074302 Plasmid Details cDNA FADS1 fatty acid desaturase 1 NA BC007846 No/No CLOSED pJP1520 mammalian:puromycin
8 HsCD00076688 Plasmid Details cDNA FADS1 fatty acid desaturase 1 NA BC007846 No/No FUSION pANT7_cGST bacterial:ampicillin
9 HsCD00288032 Plasmid Details cDNA ELOVL5 ELOVL family member 5, elongation of long chain fatty acids (FEN1/Elo2, SUR4/Elo3-like, yeast) NA BC067123.1 No/No FUSION pENTR223 bacterial:spectinomycin
10 HsCD00289090 Plasmid Details cDNA ELOVL2 elongation of very long chain fatty acids (FEN1/Elo2, SUR4/Elo3, yeast)-like 2 NA BC060809.1 No/No FUSION pENTR223 bacterial:spectinomycin
11 HsCD00304196 Plasmid Details cDNA ELOVL2 elongation of very long chain fatty acids (FEN1/Elo2, SUR4/Elo3, yeast)-like 2 NA BC060809.1 No/No FUSION pANT7_cGST bacterial:ampicillin
12 HsCD00304389 Plasmid Details cDNA ELOVL5 ELOVL family member 5, elongation of long chain fatty acids (FEN1/Elo2, SUR4/Elo3-like, yeast) NA BC067123.1 No/No FUSION pANT7_cGST bacterial:ampicillin
13 HsCD00352917 Plasmid Details cDNA ELOVL2 elongation of very long chain fatty acids (FEN1/Elo2, SUR4/Elo3, yeast)-like 2 NA HQ448547 No/No FUSION pDONR223 bacterial:spectinomycin
14 HsCD00353187 Plasmid Details cDNA ELOVL5 ELOVL family member 5, elongation of long chain fatty acids (FEN1/Elo2, SUR4/Elo3-like, yeast) NA HQ447433 No/No FUSION pDONR223 bacterial:spectinomycin
15 HsCD00356959 Plasmid Details cDNA ELOVL5 ELOVL family member 5, elongation of long chain fatty acids (FEN1/Elo2, SUR4/Elo3-like, yeast) NA HQ447433 No/No FUSION pANT7_cGST bacterial:ampicillin
16 HsCD00358077 Plasmid Details cDNA ELOVL2 elongation of very long chain fatty acids (FEN1/Elo2, SUR4/Elo3, yeast)-like 2 NA HQ448547 No/No FUSION pANT7_cGST bacterial:ampicillin
17 HsCD00435172 Plasmid Details cDNA FADS1 fatty acid desaturase 1 NA DQ893822 No/No FUSION pLX304 mammalian:blasticidin
18 HsCD00435873 Plasmid Details cDNA ELOVL2 ELOVL fatty acid elongase 2 NA HQ448547 No/No FUSION pLX304 mammalian:blasticidin
19 HsCD00509065 Plasmid Details cDNA ELOVL5 ELOVL fatty acid elongase 5 NA HQ447433 No/No FUSION pENTR223 bacterial:spectinomycin
20 HsCD00509650 Plasmid Details cDNA ELOVL2 ELOVL fatty acid elongase 2 NA HQ448547 No/No FUSION pENTR223 bacterial:spectinomycin
21 HsCD00512013 Plasmid Details cDNA FADS1 fatty acid desaturase 1 NA DQ893822 No/No FUSION pENTR223 bacterial:spectinomycin
22 HsCD00515402 Plasmid Details cDNA FADS2 fatty acid desaturase 2 NA No/No FUSION pENTR223 bacterial:spectinomycin
23 HsCD00584083 Plasmid Details cDNA ABCD1 ATP-binding cassette, sub-family D (ALD), member 1 targeted domain No/No CLOSED pET15_NESG bacterial:ampicillin
24 HsCD00584084 Plasmid Details cDNA ABCD1 ATP-binding cassette, sub-family D (ALD), member 1 targeted domain No/Yes CLOSED pET15_NESG bacterial:ampicillin
25 HsCD00584085 Plasmid Details cDNA ABCD1 ATP-binding cassette, sub-family D (ALD), member 1 targeted domain No/No CLOSED pET15_NESG bacterial:ampicillin
26 HsCD00584086 Plasmid Details cDNA ABCD1 ATP-binding cassette, sub-family D (ALD), member 1 targeted domain No/No CLOSED pET15_NESG bacterial:ampicillin
27 HsCD00584087 Plasmid Details cDNA ABCD1 ATP-binding cassette, sub-family D (ALD), member 1 targeted domain No/No CLOSED pET15_NESG bacterial:ampicillin
28 HsCD00584088 Plasmid Details cDNA ABCD1 ATP-binding cassette, sub-family D (ALD), member 1 targeted domain No/No CLOSED pET15_NESG bacterial:ampicillin
29 HsCD00629517 Plasmid Details cDNA FADS2 fatty acid desaturase 2 NA No/No FUSION pANT7_cGST bacterial:ampicillin
30 HsUT00698475 Plasmid Details 3'UTR TCF7L1 transcription factor 7-like 1 (T-cell specific, HMG-box) Sequence Verified: Yes; 3'UTR length: 1106; Forward Primer: ACCAAGTCTGCCCACTAA; Reverse Primer: TTCAGGTTTTCTAAGGGTGTCAGG NM_031283 No/No NA P2RP3 bacterial:kanamycin
31 HsCD00731373 Plasmid Details cDNA ABCD1 ATP-binding cassette, sub-family D (ALD), member 1 NA BC015541 No/No FUSION pANT7_cGST bacterial:ampicillin
No of Result Per Page : Page: