DNASU Plasmid Repository • 480.965.5697 | Email

CDKN1B (Homo sapiens) in pDNR-Dual (Creator donor/master vector)

TOP

Explanation of Terms


Gene: Gene Symbol:  CDKN1B
Gene Name:  cyclin-dependent kinase inhibitor 1B (p27, Kip1)
Sequence              Map: pDNR-Dual_with_human_insert.pdf
Original Clone ID: FLH008788.01L
Keyword: None
Species: Homo sapiens
Type: cDNA
Vector Name: pDNR-Dual               Format:  FUSION
Source: HIP
Description: None
Comments: None
Mutation/
Discrepancy :
No / Yes
Publications: None
Authors: HIP
HsCD00001057

Price:  Login for Pricing
AVAILABLE
No restriction
Special MTA: None

 

Insert sequence: 597nts         Open reading frame : 1 to 597

ATGTCAAACGTGCGAGTGTCTAACGGGAGCCCTAGCCTGGAGCGGATGGACGCCAGGCAG
GCGGAGCACCCCAAGCCCTCGGCCTGCAGGAACCTCTTCGGCCCGGTGGACCACGAAGAG
TTAACCCGGGACTTGGAGAAGCACTGCAGAGACATGGAAGAGGCGAGCCAGCGCAAGTGG
AATTTCGATTTTCAGAATCACAAACCCCTAGAGGGCAAGTACGAGTGGCAAGAGGTGGAG
AAGGGCAGCTTGCCCGAGTTCTACTACAGACCCCCGCGGCCCCCCAAAGGTGCCTGCAAG
GTGCCGGCGCAGGAGAGCCAGGATGGCAGCGGGAGCCGCCCGGCGGCGCCTTTAATTGGG
GCTCCGGCTAACTCTGAGGACACGCATTTGGTGGACCCAAAGACTGATCCGTCGGACAGC
CAGACGGGGTTAGCGGAGCAATGCGCAGGAATAAGGAAGCGACCTGCAACCGACGATTCT
TCTACTCAAAACAAAAGAGCCAACAGAACAGAAGAAAATGTTTCAGACGGTTCCCCAAAT
GCCGGTTCTGTGGAGCAGACGCCCAAGAAGCCTGGTCTCAGAAGACGTCAAACGTTG


Coding Sequence Details
Insert Sequence Verified?: Y Verification Method: Sequence Verification
Reference Sequence Annotations:
End on reference sequence 597
Start on reference sequence 1
Mutations:
None
Discrepancy:
t326g,V109G; c576t
                                

5' Linker Sequence:
5P GCGGCCGCATAACTTCGTATAGCATACATTATACGAAGTTATCAGTC
GACACC(ATG-GOI)

3' Linker Sequence:
5p (goi-stop)GGAAGCTTTCTAGACCATTCGTTTGGCGCGCGGGCCC

 

 Recommended Growth Condition:

Distributed in bacterial strain : DH5-alpha T1 phage resistant
Antibiotic Selection: Host Type:  bacterial    Marker:  ampicillin
Bacterial Selection Condition:  100 ug/mL ampicillin
Growth Condition:  Growth with the single antibiotic in LB at 37 degrees is recommended.
Comments:  Commonly used conditions for ampicillin resistant plasmid clones.
Protein Expression Results: None
Recommended expression in: Not Applicable
       DyNA Vector Map

         Powered by LabGenius

Vector Name: pDNR-Dual

pDNR-Dual in advanced viewed

Synonyms: None
Sequencing Primer: Forward:  M13F
Reverse:  Unknown
Description: Recombinational donor/master vector with 6xHN tag ORF, T7 and M13 primer sites; ampicillin resistance; restriction enzyme cloning (into) and recombinational cloning (from).
Comments: The position of features were detemined for the empty form of the vector, which is described in detail on the BD/Clontech website. Subcloning into the MCS was performed using the infusion reaction strategy and some restriction sites in the MCS may be lost after an insert is added.
Size (bp): 4938
Parent Vector: None
Empty Vector: None
Properties: Creator, donor (entry), loxP, multiple cloning site, recombinational cloning, with tag/fusion/marker
Author Name: BD Biosciences Clontech
Publications: None
Vector Map:         Vector Sequence:
Sequence:

 



Vector Features:

Type Name Description Start Position End Position
MCS MCS restriction enzyme-type multiple cloning site 45 129
bacterial origin ColE1 ColE1 (pUC-type) origin of replication 4111 4574
negative selection marker SacB SacB negative selection marker gene (sucrose sensitivity) 1057 2972
primer site M13 primer M13 primer sequencing site 4839 4855
primer site T7 primer T7 RNA Pol primer sequencing site 4865 4883
recombination site loxP site loxP recombination site 1015 1048
recombination site loxP site loxP recombination site 9 42
selectable marker CmR chloramphenicol resistance gene ORF (functional only after recombination of insert into vector with promoter) 986 327
selectable marker AmpR ampicillin resistance gene 3103 3963
splice donor site SD site splice donor site 132 136
tag HN 6xHN epitope tag 141 176

 

  • Gene
  • Pathways
  • Protein
  • Clone
  • Organism
  • Genome
  • Reagents

Gene

 

Gene Symbol : CDKN1B
Symbol Nomenclature : CDKN1B
SYNONYM : CDKN4; KIP1; MEN1B; MEN4; P27KIP1
Designation : cyclin-dependent kinase inhibitor 1B
Full Nomenclature : cyclin-dependent kinase inhibitor 1B (p27, Kip1)
GENEID : 1027
GI : 61368066
GenBank Accession : AY891167
HGNC : 1785
MIM : 600778
Vega : OTTHUMG00000149914
Target GenBank: NM_004064

 

Pathways

NCI : AP-1 transcription factor network
NCI : C-MYB transcription factor network
NCI : Class I PI3K signaling events mediated by Akt
NCI : E2F transcription factor network
NCI : FOXA1 transcription factor network
NCI : FoxO family signaling
NCI : Integrins in angiogenesis
NCI : Notch-mediated HES/HEY network
NCI : Regulation of RhoA activity
NCI : Regulation of Telomerase
NCI : Regulation of retinoblastoma protein
NCI : RhoA signaling pathway
NCI : Validated targets of C-MYC transcriptional repression
Panther : Interleukin signaling pathway
Reactome : AKT phosphorylates targets in the cytosol
Reactome : Adaptive Immune System
Reactome : Cell Cycle
Reactome : Cell Cycle Checkpoints
Reactome : Cell Cycle, Mitotic
Reactome : Cellular Senescence
Reactome : Cellular responses to stress
Reactome : Constitutive PI3K/AKT Signaling in Cancer
Reactome : Cyclin A:Cdk2-associated events at S phase entry
Reactome : Cyclin D associated events in G1
Reactome : Cyclin E associated events during G1/S transition
Reactome : DAP12 interactions
Reactome : DAP12 signaling
Reactome : DNA Damage/Telomere Stress Induced Senescence
Reactome : DNA Replication
Reactome : Disease
Reactome : Downstream signal transduction
Reactome : Downstream signaling events of B Cell Receptor (BCR)
Reactome : Downstream signaling of activated FGFR
Reactome : Fc epsilon receptor (FCERI) signaling
Reactome : G1 Phase
Reactome : G1/S DNA Damage Checkpoints
Reactome : G1/S Transition
Reactome : GAB1 signalosome
Reactome : Immune System
Reactome : Innate Immune System
Reactome : Mitotic G1-G1/S phases
Reactome : NGF signalling via TRKA from the plasma membrane
Reactome : Orc1 removal from chromatin
Reactome : PI-3K cascade
Reactome : PI3K events in ERBB2 signaling
Reactome : PI3K events in ERBB4 signaling
Reactome : PI3K/AKT Signaling in Cancer
Reactome : PI3K/AKT activation
Reactome : PIP3 activates AKT signaling
Reactome : Regulation of DNA replication
Reactome : Removal of licensing factors from origins
Reactome : Role of LAT2/NTAL/LAB on calcium mobilization
Reactome : S Phase
Reactome : SCF(Skp2)-mediated degradation of p27/p21
Reactome : Senescence-Associated Secretory Phenotype (SASP)
Reactome : Signal Transduction
Reactome : Signaling by EGFR
Reactome : Signaling by EGFR in Cancer
Reactome : Signaling by ERBB2
Reactome : Signaling by ERBB4
Reactome : Signaling by FGFR
Reactome : Signaling by FGFR in disease
Reactome : Signaling by PDGF
Reactome : Signaling by SCF-KIT
Reactome : Signaling by the B Cell Receptor (BCR)
Reactome : Signalling by NGF
Reactome : Switching of origins to a post-replicative state
Reactome : Synthesis of DNA
Reactome : p53-Dependent G1 DNA Damage Response
Reactome : p53-Dependent G1/S DNA damage checkpoint
WikiPathway : Cell cycle
WikiPathway : DNA damage response
WikiPathway : DNA damage response (only ATM dependent)
WikiPathway : Epithelium TarBase
WikiPathway : ErbB signaling pathway
WikiPathway : G1 to S cell cycle control
WikiPathway : IL-7 signaling pathway
WikiPathway : Lymphocyte TarBase
WikiPathway : Muscle cell TarBase
WikiPathway : Ovarian Infertility Genes
WikiPathway : Senescence and Autophagy
WikiPathway : TSH signaling pathway
WikiPathway : miRNA regulation of DNA Damage Response
WikiPathway : miRNAs involved in DDR

Protein

UniProt : Q6I9V6
UniProt : P46527
HPRD : 02867

Clone

Cloning Information : 8788
HIP Master Clone ID : 11283
Original Clone ID : FLH008788.01L

Organism


TAX_ID : 9606
Species Specific ID: 1027

Genome

Chromosome : 12
Map Location : 12p13.1-p12
Ensembl : ENSG00000111276

Reagents

Labome : p27-antibody