DNASU Plasmid Repository • 480.965.5697 | Email

MAPK14 (Homo sapiens) in pDNR-Dual (Creator donor/master vector)

TOP

Explanation of Terms


Gene: Gene Symbol:  MAPK14
Gene Name:  mitogen-activated protein kinase 14
Sequence              Map: pDNR-Dual_with_human_insert.pdf
Original Clone ID: FLH000091.01L
Keyword: None
Species: Homo sapiens
Type: cDNA
Vector Name: pDNR-Dual               Format:  FUSION
Source: HIP
Description: None
Comments: None
Mutation/
Discrepancy :
No / No
Publications: PMID: 15928075
Title: Building a human kinase gene repository: bioinformatics, molecular cloning, and functional validation.
Authors: HIP
HsCD00000113

Price:  Login for Pricing
AVAILABLE
No restriction
Special MTA: None

 

Insert sequence: 1083nts         Open reading frame : 1 to 1083
Reference Sequence Alignment

ATGTCTCAGGAGAGGCCCACGTTCTACCGGCAGGAGCTGAACAAGACAATCTGGGAGGTG
CCCGAGCGTTACCAGAACCTGTCTCCAGTGGGCTCTGGCGCCTATGGCTCTGTGTGTGCT
GCTTTTGACACAAAAACGGGGTTACGTGTGGCAGTGAAGAAGCTCTCCAGACCATTTCAG
TCCATCATTCATGCGAAAAGAACCTACAGAGAACTGCGGTTACTTAAACATATGAAACAT
GAAAATGTGATTGGTCTGTTGGACGTTTTTACACCTGCAAGGTCTCTGGAGGAATTCAAT
GATGTGTATCTGGTGACCCATCTCATGGGGGCAGATCTGAACAACATTGTGAAATGTCAG
AAGCTTACAGATGACCATGTTCAGTTCCTTATCTACCAAATTCTCCGAGGTCTAAAGTAT
ATACATTCAGCTGACATAATTCACAGGGACCTAAAACCTAGTAATCTAGCTGTGAATGAA
GACTGTGAGCTGAAGATTCTGGATTTTGGACTGGCTCGGCACACAGATGATGAAATGACA
GGCTACGTGGCCACTAGGTGGTACAGGGCTCCTGAGATCATGCTGAACTGGATGCATTAC
AACCAGACAGTTGATATTTGGTCAGTGGGATGCATAATGGCCGAGCTGTTGACTGGAAGA
ACATTGTTTCCTGGTACAGACCATATTGATCAGTTGAAGCTCATTTTAAGACTCGTTGGA
ACCCCAGGGGCTGAGCTTTTGAAGAAAATCTCCTCAGAGTCTGCAAGAAACTATATTCAG
TCTTTGACTCAGATGCCGAAGATGAACTTTGCGAATGTATTTATTGGTGCCAATCCCCTG
GCTGTCGACTTGCTGGAGAAGATGCTTGTATTGGACTCAGATAAGAGAATTACAGCGGCC
CAAGCCCTTGCACATGCCTACTTTGCTCAGTACCACGATCCTGATGATGAACCAGTGGCC
GATCCTTATGATCAGTCCTTTGAAAGCAGGGACCTCCTTATAGATGAGTGGAAAAGCCTG
ACCTATGATGAAGTCATCAGCTTTGTGCCACCACCCCTTGACCAAGAAGAGATGGAGTCC
TTG


Coding Sequence Details
Insert Sequence Verified?: Y Verification Method: Sequence Verification
Reference Sequence Annotations:
End on reference sequence 1445
Start on reference sequence 363
Mutations:
None
Discrepancy:
None
5' Linker Sequence:
5P GCGGCCGCATAACTTCGTATAGCATACATTATACGAAGTTATCAGTC
GACACC(ATG-GOI)

3' Linker Sequence:
5p (goi-stop)GGAAGCTTTCTAGACCATTCGTTTGGCGCGCGGGCCC

 

 Recommended Growth Condition:

Distributed in bacterial strain : DH5-alpha T1 phage resistant
Antibiotic Selection: Host Type:  bacterial    Marker:  ampicillin
Bacterial Selection Condition:  100 ug/mL ampicillin
Growth Condition:  Growth with the single antibiotic in LB at 37 degrees is recommended.
Comments:  Commonly used conditions for ampicillin resistant plasmid clones.
Protein Expression Results: None
Recommended expression in: Not Applicable
       DyNA Vector Map

         Powered by LabGenius

Vector Name: pDNR-Dual

pDNR-Dual in advanced viewed

Synonyms: None
Sequencing Primer: Forward:  M13F
Reverse:  Unknown
Description: Recombinational donor/master vector with 6xHN tag ORF, T7 and M13 primer sites; ampicillin resistance; restriction enzyme cloning (into) and recombinational cloning (from).
Comments: The position of features were detemined for the empty form of the vector, which is described in detail on the BD/Clontech website. Subcloning into the MCS was performed using the infusion reaction strategy and some restriction sites in the MCS may be lost after an insert is added.
Size (bp): 4938
Parent Vector: None
Empty Vector: None
Properties: Creator, donor (entry), loxP, multiple cloning site, recombinational cloning, with tag/fusion/marker
Author Name: BD Biosciences Clontech
Publications: None
Vector Map:         Vector Sequence:
Sequence:

 



Vector Features:

Type Name Description Start Position End Position
MCS MCS restriction enzyme-type multiple cloning site 45 129
bacterial origin ColE1 ColE1 (pUC-type) origin of replication 4111 4574
negative selection marker SacB SacB negative selection marker gene (sucrose sensitivity) 1057 2972
primer site M13 primer M13 primer sequencing site 4839 4855
primer site T7 primer T7 RNA Pol primer sequencing site 4865 4883
recombination site loxP site loxP recombination site 1015 1048
recombination site loxP site loxP recombination site 9 42
selectable marker CmR chloramphenicol resistance gene ORF (functional only after recombination of insert into vector with promoter) 986 327
selectable marker AmpR ampicillin resistance gene 3103 3963
splice donor site SD site splice donor site 132 136
tag HN 6xHN epitope tag 141 176

 

  • Gene
  • Pathways
  • Protein
  • Clone
  • Organism
  • Genome
  • Reagents

Gene

 

Gene Symbol : MAPK14
Symbol Nomenclature : MAPK14
SYNONYM : CSBP; CSBP1; CSBP2; CSPB1; EXIP; Mxi2; PRKM14; PRKM15; RK; SAPK2A; p38; p38ALPHA
Designation : CSAID-binding protein|Csaids binding protein|MAP kinase 14|MAP kinase Mxi2|MAP kinase p38 alpha|MAX-interacting protein 2|cytokine suppressive anti-inflammatory drug binding protein|cytokine suppressive anti-inflammatory drug-binding protein|mitogen-activated protein kinase p38 alpha|p38 MAP kinase|p38 mitogen activated protein kinase|p38alpha Exip|stress-activated protein kinase 2A
Full Nomenclature : mitogen-activated protein kinase 14
GENEID : 1432
Locus Tag : RP1-179N16.5
GI : 33304094
GenBank Accession : AY335728
HGNC : 6876
MIM : 600289
Vega : OTTHUMG00000159806
Target GenBank: NM_139012

 

Reference Sequence Alignment

  

HsCD00000113      ATGTCTCAGGAGAGGCCCACGTTCTACCGGCAGGAGCTGAACAAGACAATCTGGGAGGTG
NM_139012.2       ATGTCTCAGGAGAGGCCCACGTTCTACCGGCAGGAGCTGAACAAGACAATCTGGGAGGTG
NM_001315.2       ATGTCTCAGGAGAGGCCCACGTTCTACCGGCAGGAGCTGAACAAGACAATCTGGGAGGTG
                  ************************************************************

HsCD00000113      CCCGAGCGTTACCAGAACCTGTCTCCAGTGGGCTCTGGCGCCTATGGCTCTGTGTGTGCT
NM_139012.2       CCCGAGCGTTACCAGAACCTGTCTCCAGTGGGCTCTGGCGCCTATGGCTCTGTGTGTGCT
NM_001315.2       CCCGAGCGTTACCAGAACCTGTCTCCAGTGGGCTCTGGCGCCTATGGCTCTGTGTGTGCT
                  ************************************************************

HsCD00000113      GCTTTTGACACAAAAACGGGGTTACGTGTGGCAGTGAAGAAGCTCTCCAGACCATTTCAG
NM_139012.2       GCTTTTGACACAAAAACGGGGTTACGTGTGGCAGTGAAGAAGCTCTCCAGACCATTTCAG
NM_001315.2       GCTTTTGACACAAAAACGGGGTTACGTGTGGCAGTGAAGAAGCTCTCCAGACCATTTCAG
                  ************************************************************

HsCD00000113      TCCATCATTCATGCGAAAAGAACCTACAGAGAACTGCGGTTACTTAAACATATGAAACAT
NM_139012.2       TCCATCATTCATGCGAAAAGAACCTACAGAGAACTGCGGTTACTTAAACATATGAAACAT
NM_001315.2       TCCATCATTCATGCGAAAAGAACCTACAGAGAACTGCGGTTACTTAAACATATGAAACAT
                  ************************************************************

HsCD00000113      GAAAATGTGATTGGTCTGTTGGACGTTTTTACACCTGCAAGGTCTCTGGAGGAATTCAAT
NM_139012.2       GAAAATGTGATTGGTCTGTTGGACGTTTTTACACCTGCAAGGTCTCTGGAGGAATTCAAT
NM_001315.2       GAAAATGTGATTGGTCTGTTGGACGTTTTTACACCTGCAAGGTCTCTGGAGGAATTCAAT
                  ************************************************************

HsCD00000113      GATGTGTATCTGGTGACCCATCTCATGGGGGCAGATCTGAACAACATTGTGAAATGTCAG
NM_139012.2       GATGTGTATCTGGTGACCCATCTCATGGGGGCAGATCTGAACAACATTGTGAAATGTCAG
NM_001315.2       GATGTGTATCTGGTGACCCATCTCATGGGGGCAGATCTGAACAACATTGTGAAATGTCAG
                  ************************************************************

HsCD00000113      AAGCTTACAGATGACCATGTTCAGTTCCTTATCTACCAAATTCTCCGAGGTCTAAAGTAT
NM_139012.2       AAGCTTACAGATGACCATGTTCAGTTCCTTATCTACCAAATTCTCCGAGGTCTAAAGTAT
NM_001315.2       AAGCTTACAGATGACCATGTTCAGTTCCTTATCTACCAAATTCTCCGAGGTCTAAAGTAT
                  ************************************************************

HsCD00000113      ATACATTCAGCTGACATAATTCACAGGGACCTAAAACCTAGTAATCTAGCTGTGAATGAA
NM_139012.2       ATACATTCAGCTGACATAATTCACAGGGACCTAAAACCTAGTAATCTAGCTGTGAATGAA
NM_001315.2       ATACATTCAGCTGACATAATTCACAGGGACCTAAAACCTAGTAATCTAGCTGTGAATGAA
                  ************************************************************

HsCD00000113      GACTGTGAGCTGAAGATTCTGGATTTTGGACTGGCTCGGCACACAGATGATGAAATGACA
NM_139012.2       GACTGTGAGCTGAAGATTCTGGATTTTGGACTGGCTCGGCACACAGATGATGAAATGACA
NM_001315.2       GACTGTGAGCTGAAGATTCTGGATTTTGGACTGGCTCGGCACACAGATGATGAAATGACA
                  ************************************************************

HsCD00000113      GGCTACGTGGCCACTAGGTGGTACAGGGCTCCTGAGATCATGCTGAACTGGATGCATTAC
NM_139012.2       GGCTACGTGGCCACTAGGTGGTACAGGGCTCCTGAGATCATGCTGAACTGGATGCATTAC
NM_001315.2       GGCTACGTGGCCACTAGGTGGTACAGGGCTCCTGAGATCATGCTGAACTGGATGCATTAC
                  ************************************************************

HsCD00000113      AACCAGACAGTTGATATTTGGTCAGTGGGATGCATAATGGCCGAGCTGTTGACTGGAAGA
NM_139012.2       AACCAGACAGTTGATATTTGGTCAGTGGGATGCATAATGGCCGAGCTGTTGACTGGAAGA
NM_001315.2       AACCAGACAGTTGATATTTGGTCAGTGGGATGCATAATGGCCGAGCTGTTGACTGGAAGA
                  ************************************************************

HsCD00000113      ACATTGTTTCCTGGTACAGACCATATTGATCAGTTGAAGCTCATTTTAAGACTCGTTGGA
NM_139012.2       ACATTGTTTCCTGGTACAGACCATATTGATCAGTTGAAGCTCATTTTAAGACTCGTTGGA
NM_001315.2       ACATTGTTTCCTGGTACAGACCATATTAACCAGCTTCAGCAGATTATGCGTCTGACAGGA
                  ***************************.* *** * .***: ***:*..*:** . :***

HsCD00000113      ACCCCAGGGGCTGAGCTTTTGAAGAAAATCTCCTCAGAGTCTGCAAGAAACTATATTCAG
NM_139012.2       ACCCCAGGGGCTGAGCTTTTGAAGAAAATCTCCTCAGAGTCTGCAAGAAACTATATTCAG
NM_001315.2       ACACCCCCCGCTTATCTCATTAACAGGATGCCAAGCCATGAGGCAAGAAACTATATTCAG
                  **.**.   *** * ** :* ** *..**  *.: . *  . ******************

HsCD00000113      TCTTTGACTCAGATGCCGAAGATGAACTTTGCGAATGTATTTATTGGTGCCAATCCCCTG
NM_139012.2       TCTTTGACTCAGATGCCGAAGATGAACTTTGCGAATGTATTTATTGGTGCCAATCCCCTG
NM_001315.2       TCTTTGACTCAGATGCCGAAGATGAACTTTGCGAATGTATTTATTGGTGCCAATCCCCTG
                  ************************************************************

HsCD00000113      GCTGTCGACTTGCTGGAGAAGATGCTTGTATTGGACTCAGATAAGAGAATTACAGCGGCC
NM_139012.2       GCTGTCGACTTGCTGGAGAAGATGCTTGTATTGGACTCAGATAAGAGAATTACAGCGGCC
NM_001315.2       GCTGTCGACTTGCTGGAGAAGATGCTTGTATTGGACTCAGATAAGAGAATTACAGCGGCC
                  ************************************************************

HsCD00000113      CAAGCCCTTGCACATGCCTACTTTGCTCAGTACCACGATCCTGATGATGAACCAGTGGCC
NM_139012.2       CAAGCCCTTGCACATGCCTACTTTGCTCAGTACCACGATCCTGATGATGAACCAGTGGCC
NM_001315.2       CAAGCCCTTGCACATGCCTACTTTGCTCAGTACCACGATCCTGATGATGAACCAGTGGCC
                  ************************************************************

HsCD00000113      GATCCTTATGATCAGTCCTTTGAAAGCAGGGACCTCCTTATAGATGAGTGGAAAAGCCTG
NM_139012.2       GATCCTTATGATCAGTCCTTTGAAAGCAGGGACCTCCTTATAGATGAGTGGAAAAGCCTG
NM_001315.2       GATCCTTATGATCAGTCCTTTGAAAGCAGGGACCTCCTTATAGATGAGTGGAAAAGCCTG
                  ************************************************************

HsCD00000113      ACCTATGATGAAGTCATCAGCTTTGTGCCACCACCCCTTGACCAAGAAGAGATGGAGTCC
NM_139012.2       ACCTATGATGAAGTCATCAGCTTTGTGCCACCACCCCTTGACCAAGAAGAGATGGAGTCC
NM_001315.2       ACCTATGATGAAGTCATCAGCTTTGTGCCACCACCCCTTGACCAAGAAGAGATGGAGTCC
                  ************************************************************

HsCD00000113      TTG
NM_139012.2       TGA
NM_001315.2       TGA
                  * .

Pathways

NCI : ATF-2 transcription factor network
NCI : Angiopoietin receptor Tie2-mediated signaling
NCI : Atypical NF-kappaB pathway
NCI : BCR signaling pathway
NCI : CD40/CD40L signaling
NCI : CDC42 signaling events
NCI : CXCR3-mediated signaling events
NCI : EPO signaling pathway
NCI : Endothelins
NCI : FAS (CD95) signaling pathway
NCI : FGF signaling pathway
NCI : Glucocorticoid receptor regulatory network
NCI : IL12-mediated signaling events
NCI : IL2-mediated signaling events
NCI : IL4-mediated signaling events
NCI : IL6-mediated signaling events
NCI : RAC1 signaling pathway
NCI : Rapid glucocorticoid signaling
NCI : Regulation of Androgen receptor activity
NCI : Regulation of p38-alpha and p38-beta
NCI : Regulation of retinoblastoma protein
NCI : Retinoic acid receptors-mediated signaling
NCI : Role of Calcineurin-dependent NFAT signaling in lymphocytes
NCI : S1P2 pathway
NCI : Signaling events mediated by VEGFR1 and VEGFR2
NCI : Signaling mediated by p38-alpha and p38-beta
NCI : Thromboxane A2 receptor signaling
NCI : Trk receptor signaling mediated by the MAPK pathway
NCI : VEGFR3 signaling in lymphatic endothelium
NCI : p38 MAPK signaling pathway
NCI : p38 signaling mediated by MAPKAP kinases
NCI : p53 pathway
NCI : p73 transcription factor network
Panther : Alzheimer disease-amyloid secretase pathway
Panther : Angiogenesis
Panther : B cell activation
Panther : EGF receptor signaling pathway
Panther : FGF signaling pathway
Panther : Interferon-gamma signaling pathway
Panther : Oxidative stress response
Panther : Parkinson disease
Panther : Ras Pathway
Panther : TGF-beta signaling pathway
Panther : Toll receptor signaling pathway
Panther : VEGF signaling pathway
Panther : p38 MAPK pathway
Panther : p53 pathway feedback loops 2
Reactome : ADP signalling through P2Y purinoceptor 1
Reactome : Activated TLR4 signalling
Reactome : Activation of PPARGC1A (PGC-1alpha) by phosphorylation
Reactome : Activation of the AP-1 family of transcription factors
Reactome : CDO in myogenesis
Reactome : Cell-Cell communication
Reactome : Cellular Senescence
Reactome : Cellular responses to stress
Reactome : DSCAM interactions
Reactome : Developmental Biology
Reactome : ERK/MAPK targets
Reactome : Gene Expression
Reactome : Hemostasis
Reactome : Immune System
Reactome : Innate Immune System
Reactome : KSRP destabilizes mRNA
Reactome : MAP kinase activation in TLR cascade
Reactome : MAPK targets/ Nuclear events mediated by MAP kinases
Reactome : Metabolism of RNA
Reactome : Metabolism of mRNA
Reactome : Mitochondrial biogenesis
Reactome : MyD88 cascade initiated on plasma membrane
Reactome : MyD88 dependent cascade initiated on endosome
Reactome : MyD88-independent cascade
Reactome : MyD88:Mal cascade initiated on plasma membrane
Reactome : Myogenesis
Reactome : NGF signalling via TRKA from the plasma membrane
Reactome : NOD1/2 Signaling Pathway
Reactome : Nuclear Events (kinase and transcription factor activation)
Reactome : Nucleotide-binding domain, leucine rich repeat containing receptor (NLR) signaling pathways
Reactome : Organelle biogenesis and maintenance
Reactome : Oxidative Stress Induced Senescence
Reactome : Platelet activation, signaling and aggregation
Reactome : Platelet homeostasis
Reactome : Platelet sensitization by LDL
Reactome : Regulation of mRNA stability by proteins that bind AU-rich elements
Reactome : Signal Transduction
Reactome : Signal amplification
Reactome : Signalling by NGF
Reactome : Signalling to ERKs
Reactome : Signalling to RAS
Reactome : TRAF6 Mediated Induction of proinflammatory cytokines
Reactome : TRAF6 mediated induction of NFkB and MAP kinases upon TLR7/8 or 9 activation
Reactome : TRIF-mediated TLR3/TLR4 signaling
Reactome : Toll Like Receptor 10 (TLR10) Cascade
Reactome : Toll Like Receptor 2 (TLR2) Cascade
Reactome : Toll Like Receptor 3 (TLR3) Cascade
Reactome : Toll Like Receptor 4 (TLR4) Cascade
Reactome : Toll Like Receptor 5 (TLR5) Cascade
Reactome : Toll Like Receptor 7/8 (TLR7/8) Cascade
Reactome : Toll Like Receptor 9 (TLR9) Cascade
Reactome : Toll Like Receptor TLR1:TLR2 Cascade
Reactome : Toll Like Receptor TLR6:TLR2 Cascade
Reactome : Toll-Like Receptors Cascades
Reactome : activated TAK1 mediates p38 MAPK activation
Reactome : p38MAPK events
WikiPathway : Alpha 6 Beta 4 signaling pathway
WikiPathway : B Cell Receptor Signaling Pathway
WikiPathway : EGF/EGFR Signaling Pathway
WikiPathway : Energy Metabolism
WikiPathway : Epithelium TarBase
WikiPathway : Estrogen signaling pathway
WikiPathway : FSH signaling pathway
WikiPathway : IL-1 signaling pathway
WikiPathway : IL-4 signaling pathway
WikiPathway : Insulin Signaling
WikiPathway : Kit receptor signaling pathway
WikiPathway : Leptin signaling pathway
WikiPathway : Leukocyte TarBase
WikiPathway : Lymphocyte TarBase
WikiPathway : MAPK Cascade
WikiPathway : MAPK signaling pathway
WikiPathway : MicroRNAs in cardiomyocyte hypertrophy
WikiPathway : Monoamine Transport
WikiPathway : Muscle cell TarBase
WikiPathway : Oxidative Stress
WikiPathway : Physiological and Pathological Hypertrophy of the Heart
WikiPathway : Prolactin Signaling Pathway
WikiPathway : RANKL/RANK Signaling Pathway
WikiPathway : Regulation of toll-like receptor signaling pathway
WikiPathway : Senescence and Autophagy
WikiPathway : Serotonin HTR1 Group and FOS Pathway
WikiPathway : TCR Signaling Pathway
WikiPathway : TGF beta Signaling Pathway
WikiPathway : TSH signaling pathway
WikiPathway : TWEAK Signaling Pathway
WikiPathway : Toll-like receptor signaling pathway
WikiPathway : angiogenesis overview
WikiPathway : p38 MAPK Signaling Pathway

Clone

Cloning Information : 91
HIP Master Clone ID : 87325
Original Clone ID : FLH000091.01L

Organism


TAX_ID : 9606
Species Specific ID: 1432

Genome

Chromosome : 6
Map Location : 6p21.3-p21.2
Ensembl : ENSG00000112062

Reagents

Labome : p38-antibody