DNASU Plasmid Repository • 480.965.5697 | Email

FN1 (Homo sapiens) in pDONR201 (Gateway donor/master vector)


Explanation of Terms

Gene: Gene Symbol:  FN1
Gene Name:  fibronectin 1
Sequence              Map: pDONR cofig.pdf
Original Clone ID: FLH054009.01L
Keyword: None
Species: Homo sapiens
Type: cDNA
Vector Name: pDONR201               Format:  FUSION
Source: HIP
Description: None
Comments: None
Discrepancy :
No / No
Publications: None
Authors: HIP

Price:  Login for Pricing
No restriction
Special MTA: None


Insert sequence: 492nts         Open reading frame : 1 to 492
Reference Sequence Alignment


Coding Sequence Details
Insert Sequence Verified?: Y Verification Method: Sequence Verification
Reference Sequence Annotations:
End on reference sequence 646
Start on reference sequence 155
5' Linker Sequence:

3' Linker Sequence:


 Recommended Growth Condition:

Distributed in bacterial strain : DH5-alpha T1 phage resistant
Antibiotic Selection: Host Type:  bacterial    Marker:  kanamycin
Bacterial Selection Condition:  50ug/mL kanamycin
Growth Condition:  Growth with the single antibiotic in LB at 37 degrees is recommended.
Comments:  Conditions for Gateway-type vectors in recombined (with insert) form and other kanamycin resistant vectors.
Protein Expression Results: None
Recommended expression in: Not Applicable
       DyNA Vector Map

         Powered by LabGenius

Vector Name: pDONR201

pDONR201 in advanced viewed

Synonyms: None
Sequencing Primer: Forward:  pDONR201-forward
Reverse:  pDONR201-reverse
Description: Recombinational donor/master vector; kanamycin resistance; recombinational cloning.
Comments: The position of features were determined for the unrecombined (empty) form of the vector, which is described in detail on the Invitrogen website.
Size (bp): 4470
Parent Vector: None
Empty Vector: None
Properties: Gateway, donor (entry), recombinational cloning
Author Name: Invitrogen
Publications: None
Vector Map:         Vector Sequence:


Vector Features:

Type Name Description Start Position End Position
bacterial origin ColE ColE1 (pUC-type) origin of replication (modified, low copy number) 3744 4426
negative selection marker ccdB ccdB negative selection gene (death cassette), LOST in recombined (with insert) form 1264 959
primer site forward primer recommended forward primer site 5 tcgcgttaacgctagcatggatctc 3 300 324
primer site reverse primer recommended reverse primer site 5 gtaacatcagagattttgagacac 3 2769 2792
recombination site attL2 attL recombination site 2 present in recombined (with insert) form only, position is approximate 2744 2513
recombination site attP1 attP recombination site 1 LOST in recombined (with insert) form 332 563
recombination site attP2 attP recombination site 2 LOST in recombined (with insert) form 2744 2513
recombination site attL1 attL recombination site 1 present in recombined (with insert) form only, position is approximate 332 563
selectable marker CmR chloramphenicol resistance gene, LOST in recombined (with insert) form 2265 2513
selectable marker KanR kanamycin resistance gene 2868 3677
trxn termination sequence rrn T2 rrn T2 transcription termination sequence 73 100
trxn termination sequence rrn T1 rrn T1 transcription termination sequence 232 275


  • Gene
  • Pathways
  • Protein
  • Clone
  • Organism
  • Genome
  • Reagents



Gene Symbol : FN1
Symbol Nomenclature : FN1
Designation : cold-insoluble globulin|fibronectin|migration-stimulating factor
Full Nomenclature : fibronectin 1
GENEID : 2335
GI : 60827392
GenBank Accession : AY893760
HGNC : 3778
MIM : 135600
Vega : OTTHUMG00000133054
Target GenBank: BC005858


Reference Sequence Alignment


HsCD00001186        ------------------------------------------------------------

HsCD00001186        ------------------------------------------------------------

HsCD00001186        ------------------------------------------------------------

HsCD00001186        ------------------------------------------------------------

HsCD00001186        ------------------------------------------------------------

HsCD00001186        ------------------------------------------------------------

HsCD00001186        ------------------------------------------------------------

HsCD00001186        ------------------------------------------------------------

HsCD00001186        ------------------------------------------------------------

HsCD00001186        ------------------------------------------------------------

HsCD00001186        ------------------------------------------------------------

HsCD00001186        ------------------------------------------------------------

HsCD00001186        ------------------------------------------------------------

HsCD00001186        ------------------------------------------------------------

HsCD00001186        ------------------------------------------------------------

HsCD00001186        ------------------------------------------------------------

HsCD00001186        ------------------------------------------------------------

HsCD00001186        ------------------------------------------------------------

HsCD00001186        ------------------------------------------------------------

HsCD00001186        ------------------------------------------------------------

HsCD00001186        ------------------------------------------------------------

HsCD00001186        ------------------------------------------------------------

HsCD00001186        ------------------------------------------------------------

HsCD00001186        ------------------------------------------------------------

HsCD00001186        ------------------------------------------------------------

HsCD00001186        ------------------------------------------------------------

HsCD00001186        ------------------------------------------------------------

HsCD00001186        ------------------------------------------------------------

HsCD00001186        ------------------------------------------------------------

HsCD00001186        ------------------------------------------------------------

HsCD00001186        ------------------------------------------------------------

HsCD00001186        ------------------------------------------------------------

HsCD00001186        ------------------------------------------------------------

HsCD00001186        ------------------------------------------------------------

HsCD00001186        ------------------------------------------------------------

HsCD00001186        ------------------------------------------------------------

HsCD00001186        ------------------------------------------------------------

HsCD00001186        ------------------------------------------------------------

HsCD00001186        ------------------------------------------------------------

HsCD00001186        ------------------------------------------------------------

HsCD00001186        ------------------------------------------------------------

HsCD00001186        ------------------------------------------------------------

HsCD00001186        ------------------------------------------------------------

HsCD00001186        ------------------------------------------------------------

HsCD00001186        ------------------------------------------------------------

HsCD00001186        ------------------------------------------------------------

HsCD00001186        ------------------------------------------------------------

HsCD00001186        ------------------------------------------------------------

HsCD00001186        ------------------------------------------------------------

HsCD00001186        ------------------------------------------------------------

HsCD00001186        ------------------------------------------------------------

HsCD00001186        ------------------------------------------------------------

HsCD00001186        ------------------------------------------------------------

HsCD00001186        ------------------------------------------------------------

HsCD00001186        ------------------------------------------------------------

HsCD00001186        ------------------------------------------------------------

HsCD00001186        ------------------------------------------------------------

HsCD00001186        ------------------------------------------------------------

HsCD00001186        ------------------------------------------------------------

HsCD00001186        ------------------------------------------------------------

HsCD00001186        ------------------------------------------------------------

HsCD00001186        ------------------------------------------------------------

HsCD00001186        ------------------------------------------------------------

HsCD00001186        ------------------------------------------------------------
XM_005246414.1      GATACCATCATCCCAGCTGT----------------------------------------
NM_212474.1         GATACCATCATCCCAGCTGT----------------------------------------
XM_005246415.1      GATACCATCATCCCAGCTGT----------------------------------------
NM_212478.1         GATACCATCATCCCAGCTGT----------------------------------------
XM_005246409.1      GATACCATCATCCCAGCTGT----------------------------------------
XM_005246417.1      GATACCATCATCCCAGCTGT----------------------------------------
NM_002026.2         GATACCATCATCCCAGCTGT----------------------------------------
XM_005246406.1      GATACCATCATCCCAGCTGT----------------------------------------
XM_005246412.1      GATACCATCATCCCAGCTGT----------------------------------------
NM_212476.1         GATACCATCATCCCAGCTGT----------------------------------------

HsCD00001186        ------------------------------------------------------------
XM_005246414.1      ------------------------------------------------------------
NM_212474.1         ------------------------------------------------------------
XM_005246415.1      ------------------------------------------------------------
NM_212478.1         ------------------------------------------------------------
XM_005246409.1      ------------------------------------------------------------
XM_005246417.1      ------------------------------------------------------------
NM_002026.2         ------------------------------------------------------------
XM_005246406.1      ------------------------------------------------------------
XM_005246412.1      ------------------------------------------------------------
NM_212476.1         ------------------------------------------------------------

HsCD00001186        ------------------------------------------------------------
XM_005246414.1      ------------------------------------------------------------
NM_212474.1         ------------------------------------------------------------
XM_005246415.1      ------------------------------------------------------------
NM_212478.1         ------------------------------------------------------------
XM_005246409.1      ------------------------------------------------------------
XM_005246417.1      ------------------------------------------------------------
NM_002026.2         ------------------------------------------------------------
XM_005246406.1      ------------------------------------------------------------
XM_005246412.1      ------------------------------------------------------------
NM_212476.1         ------------------------------------------------------------

HsCD00001186        ------------------------------------------------------------
XM_005246414.1      ------------------------------------------------------------
NM_212474.1         ------------------------------------------------------------
XM_005246415.1      ------------------------------------------------------------
NM_212478.1         ------------------------------------------------------------
XM_005246409.1      ------------------------------------------------------------
XM_005246417.1      ------------------------------------------------------------
NM_002026.2         ------------------------------------------------------------
XM_005246406.1      ------------------------------------------------------------
XM_005246412.1      ------------------------------------------------------------
NM_212476.1         ------------------------------------------------------------

HsCD00001186        ------------------------------------------------------------
XM_005246414.1      -----------------------------------------------------TCCTCCT
NM_212474.1         -----------------------------------------------------TCCTCCT
XM_005246415.1      -----------------------------------------------------TCCTCCT
NM_212478.1         -----------------------------------------------------TCCTCCT
XM_005246409.1      -----------------------------------------------------TCCTCCT
XM_005246417.1      -----------------------------------------------------TCCTCCT
NM_002026.2         -----------------------------------------------------TCCTCCT
XM_005246406.1      -----------------------------------------------------TCCTCCT
XM_005246412.1      -----------------------------------------------------TCCTCCT
NM_212476.1         -----------------------------------------------------TCCTCCT

HsCD00001186        ------------------------------------------------------------

HsCD00001186        ------------------------------------------------------------

HsCD00001186        ------------------------------------------------------------

HsCD00001186        ------------------------------------------------------------

HsCD00001186        ------------------------------------------------------------

HsCD00001186        ------------------------------------------------------------

HsCD00001186        ------------------------------------------------------------

HsCD00001186        ------------------------------------------------------------

HsCD00001186        ------------------------------------------------------------

HsCD00001186        ------------------------------------------------------------

HsCD00001186        ------------------------------------------------------------

HsCD00001186        ------------------------------------------------------------

HsCD00001186        ------------------------------------------------------------

HsCD00001186        ------------------------------------------------------------

HsCD00001186        ------------------------------------------------------------

HsCD00001186        ------------------------------------------------------------

HsCD00001186        ------------------------------------------------------------

HsCD00001186        ------------------------------------------------------------

HsCD00001186        ------------------------------------------------------------
NM_212474.1         ACCACTATTCCTG-----------------------------------------------
XM_005246415.1      ACCACTATTCCT------------------------------------------------
XM_005246417.1      ACCACTATTCCTG-----------------------------------------------
XM_005246412.1      ACCACTAT---T-CCTG-------------------------------------------
NM_212476.1         ACCACTATTCCT------------------------------------------------
XM_005246405.1      ACCACTATTCCTG-----------------------------------------------
XM_005246413.1      ACCACTATTCCTG-----------------------------------------------

HsCD00001186        ------------------------------------------------------------
NM_212474.1         ------------------------------------------------------------
XM_005246415.1      ------------------------------------------------------------
XM_005246417.1      ------------------------------------------------------------
XM_005246412.1      ------------------------------------------------------------
NM_212476.1         ------------------------------------------------------------
XM_005246405.1      ------------------------------------------------------------
XM_005246413.1      ------------------------------------------------------------

HsCD00001186        ------------------------------------------------------------
NM_212474.1         ------------------------------------------------------------
XM_005246415.1      ------------------------------------------------------------
XM_005246417.1      ------------------------------------------------------------
XM_005246412.1      ------------------------------------------------------------
NM_212476.1         ------------------------------------------------------------
XM_005246405.1      ------------------------------------------------------------
XM_005246413.1      ------------------------------------------------------------

HsCD00001186        ------------------------------------------------------------
NM_212474.1         ------------------------------------------------------------
XM_005246415.1      ------------------------------------------------------------
XM_005246417.1      ------------------------------------------------------------
XM_005246412.1      ------------------------------------------------------------
NM_212476.1         ------------------------------------------------------------
XM_005246405.1      ------------------------------------------------------------
XM_005246413.1      ------------------------------------------------------------

HsCD00001186        ------------------------------------------------------------
NM_212474.1         -----------------------------------------------CACCAACTGACCT
XM_005246415.1      ----------------------------------------------GCACCAACTGACCT
XM_005246417.1      -----------------------------------------------CACCAACTGACCT
XM_005246412.1      -----------------------------------------------CACCAACTGACCT
NM_212476.1         ----------------------------------------------GCACCAACTGACCT
XM_005246405.1      -----------------------------------------------CACCAACTGACCT
XM_005246413.1      -----------------------------------------------CACCAACTGACCT

HsCD00001186        ------------------------------------------------------------

HsCD00001186        ------------------------------------------------------------

HsCD00001186        ------------------------------------------------------------

HsCD00001186        ------------------------------------------------------------

HsCD00001186        ------------------------------------------------------------

HsCD00001186        ------------------------------------------------------------

HsCD00001186        ------------------------------------------------------------

HsCD00001186        ------------------------------------------------------------

HsCD00001186        ------------------------------------------------------------

HsCD00001186        ------------------------------------------------------------

HsCD00001186        ------------------------------------------------------------

HsCD00001186        ------------------------------------------------------------

HsCD00001186        ------------------------------------------------------------

HsCD00001186        ------------------------------------------------------------
XM_005246414.1      AAGGAAAAAGACAG----------------------------------------------
XM_005246402.1      AAGGAAAAAGACAGTT--------------------------------------------
NM_212474.1         ------------------------------------------------------------
NM_212478.1         AAGGAAAAAGACAGTT--------------------------------------------
XM_005246409.1      AAG---------------------------------------------------------
XM_005246417.1      ------------------------------------------------------------
XM_005246412.1      AAG---------------------------------------------------------
XM_005246413.1      AAG---------------------------------------------------------

HsCD00001186        ------------------------------------------------------------
XM_005246414.1      ------------------------------------------------------------
XM_005246402.1      -------------------------------CAAAAGACCCCTTTCGTCACCCACCCTGG
NM_212474.1         ------------------------------------------------------------
NM_212478.1         -------------------------------CAAAAGACCCCTTTCGTCACCCACCCTGG
XM_005246413.1      ------------------------------------------------------------

HsCD00001186        ------------------------------------------------------------
XM_005246414.1      ------------------------------------------------------------
NM_212474.1         ------------------------------------------------------------
XM_005246413.1      ------------------------------------------------------------

HsCD00001186        ------------------------------------------------------------
XM_005246414.1      ------------------------------------------------------------
NM_212474.1         ------------------------------------------------------------
XM_005246413.1      ------------------------------------------------------------

HsCD00001186        ------------------------------------------------------------
XM_005246414.1      ------------------------------------------------------------
NM_212474.1         ------------------------------------------------------------
XM_005246413.1      ------------------------------------------------------------

HsCD00001186        ------------------------------------------------------------
XM_005246414.1      ------------------------------------------------------------
XM_005246402.1      ------------------------------------------------------------
NM_212474.1         -----------------------------------------------------------G
XM_005246415.1      ------------------------------------------------------------
NM_212478.1         ------------------------------------------------------------
XM_005246417.1      ------------------------------------------------------------
NM_002026.2         ------------------------------------------------------------
XM_005246400.1      ------------------------------------------------------------
XM_005246413.1      ------------------------------------------------------------

HsCD00001186        ------------------------------------------------------------

HsCD00001186        ------------------------------------------------------------

HsCD00001186        ------------------------------------------------------------

HsCD00001186        ------------------------------------------------------------

HsCD00001186        ------------------------------------------------------------

HsCD00001186        -------------------------------------------------ATGTCTGAATC









HsCD00001186        G
XM_005246414.1      A
XM_005246402.1      A
NM_212474.1         A
XM_005246415.1      A
NM_212478.1         A
XM_005246409.1      A
XM_005246417.1      A
NM_002026.2         A
XM_005246406.1      A
XM_005246412.1      A
XM_005246400.1      A
NM_212476.1         A
XM_005246405.1      A
XM_005246413.1      A
NM_212482.1         A


NCI : Alpha4 beta1 integrin signaling events
NCI : Alpha9 beta1 integrin signaling events
NCI : Angiopoietin receptor Tie2-mediated signaling
NCI : Beta1 integrin cell surface interactions
NCI : Beta3 integrin cell surface interactions
NCI : Beta5 beta6 beta7 and beta8 integrin cell surface interactions
NCI : Integrins in angiogenesis
NCI : Syndecan-2-mediated signaling events
NCI : Syndecan-4-mediated signaling events
NCI : Urokinase-type plasminogen activator (uPA) and uPAR-mediated signaling
NCI : VEGFR3 signaling in lymphatic endothelium
Panther : Integrin signalling pathway
Reactome : Cell surface interactions at the vascular wall
Reactome : Extracellular matrix organization
Reactome : Fibronectin matrix formation
Reactome : GRB2:SOS provides linkage to MAPK signaling for Integrins
Reactome : Hemostasis
Reactome : Integrin alphaIIb beta3 signaling
Reactome : Integrin cell surface interactions
Reactome : Platelet Aggregation (Plug Formation)
Reactome : Platelet activation, signaling and aggregation
Reactome : Platelet degranulation
Reactome : Response to elevated platelet cytosolic Ca2+
Reactome : Signal Transduction
Reactome : p130Cas linkage to MAPK signaling for integrins
WikiPathway : Focal Adhesion
WikiPathway : Inflammatory Response Pathway
WikiPathway : Regulation of Actin Cytoskeleton
WikiPathway : Senescence and Autophagy


SMART domain : FN1 : Fibronectin type 1 domain
UniProt : Q6MZF4
UniProt : Q6N084
UniProt : P02751
UniProt : Q9UQS6
UniProt : Q6MZM7
UniProt : E9PG29
HPRD : 00626


Cloning Information : 54009
HIP Master Clone ID : 10270
Original Clone ID : FLH054009.01L


TAX_ID : 9606
Species Specific ID: 2335


Chromosome : 2
Map Location : 2q34
Ensembl : ENSG00000115414


Labome : fibronectin-antibody