DNASU Plasmid Repository • 480.965.5697 | Email

PCNA (Homo sapiens) in pDONR201 (Gateway donor/master vector)


Explanation of Terms

Gene: Gene Symbol:  PCNA
Gene Name:  proliferating cell nuclear antigen
Sequence              Map: pDONR cofig.pdf
Original Clone ID: FLH058411.01X
Keyword: None
Species: Homo sapiens
Type: cDNA
Vector Name: pDONR201               Format:  CLOSED
Source: HIP
Description: None
Comments: None
Discrepancy :
No / Yes
Publications: None
Authors: HIP

Price:  Login for Pricing
No restriction
Special MTA: None


Insert sequence: 786nts        
Open reading frame : 1 to 786
Reference Sequence Alignment


Coding Sequence Details
Insert Sequence Verified?: Y Verification Method: Sequence Verification
Reference Sequence Annotations:
Start on reference sequence 119
End on reference sequence 904

5' Linker Sequence:

3' Linker Sequence:


 Recommended Growth Condition:

Distributed in bacterial strain : DH5-alpha T1 phage resistant
Antibiotic Selection: Host Type:  bacterial    Marker:  kanamycin
Bacterial Selection Condition:  50ug/mL kanamycin
Growth Condition:  Growth with the single antibiotic in LB at 37 degrees is recommended.
Comments:  Conditions for Gateway-type vectors in recombined (with insert) form and other kanamycin resistant vectors.
Protein Expression Results: None
Recommended expression in: Not Applicable
       DyNA Vector Map

         Powered by LabGenius

Vector Name: pDONR201

pDONR201 in advanced viewed

Synonyms: ''
Sequencing Primer: Forward:  pDONR201-forward
Reverse:  pDONR201-reverse
Description: Recombinational donor/master vector; kanamycin resistance; recombinational cloning.
Comments: The position of features were determined for the unrecombined (empty) form of the vector, which is described in detail on the Invitrogen website.
Size (bp): 4470
Parent Vector: None
Empty Vector: None
Properties: Gateway, donor (entry), recombinational cloning
Author Name: Invitrogen
Publications: None
Vector Map:         Vector Sequence:


Vector Features:

Type Name Description Start Position End Position
bacterial origin ColE ColE1 (pUC-type) origin of replication (modified, low copy number) 3744 4426
negative selection marker ccdB ccdB negative selection gene (death cassette), LOST in recombined (with insert) form 1264 959
primer site forward primer recommended forward primer site 5 tcgcgttaacgctagcatggatctc 3 300 324
primer site reverse primer recommended reverse primer site 5 gtaacatcagagattttgagacac 3 2769 2792
recombination site attP1 attP recombination site 1 LOST in recombined (with insert) form 332 563
recombination site attP2 attP recombination site 2 LOST in recombined (with insert) form 2744 2513
recombination site attL1 attL recombination site 1 present in recombined (with insert) form only, position is approximate 332 563
recombination site attL2 attL recombination site 2 present in recombined (with insert) form only, position is approximate 2744 2513
selectable marker CmR chloramphenicol resistance gene, LOST in recombined (with insert) form 2265 2513
selectable marker KanR kanamycin resistance gene 2868 3677
trxn termination sequence rrn T2 rrn T2 transcription termination sequence 73 100
trxn termination sequence rrn T1 rrn T1 transcription termination sequence 232 275


  • Gene
  • Pathways
  • Protein
  • Clone
  • Organism
  • Genome
  • Reagents



Gene Symbol : PCNA
Symbol Nomenclature : PCNA
Designation : DNA polymerase delta auxiliary protein|cyclin
Full Nomenclature : proliferating cell nuclear antigen
GENEID : 5111
GI : 60815710
GenBank Accession : AY893318
HGNC : 8729
MIM : 176740
Vega : OTTHUMG00000031798
Target GenBank: NM_002592


Reference Sequence Alignment


                  ****** *****************************************************













HsCD00001218      TCTTAG
NM_182649.1       TCTTAG
NM_002592.2       TCTTAG


NCI : BARD1 signaling events
NCI : Direct p53 effectors
NCI : Validated nuclear estrogen receptor alpha network
Panther : DNA replication
Reactome : Base Excision Repair
Reactome : Cell Cycle
Reactome : Cell Cycle, Mitotic
Reactome : Chromosome Maintenance
Reactome : DNA Repair
Reactome : DNA Replication
Reactome : DNA strand elongation
Reactome : E2F mediated regulation of DNA replication
Reactome : Extension of Telomeres
Reactome : G0 and Early G1
Reactome : G1/S Transition
Reactome : G1/S-Specific Transcription
Reactome : Gap-filling DNA repair synthesis and ligation in GG-NER
Reactome : Gap-filling DNA repair synthesis and ligation in TC-NER
Reactome : Global Genomic NER (GG-NER)
Reactome : Lagging Strand Synthesis
Reactome : Leading Strand Synthesis
Reactome : Mitotic G1-G1/S phases
Reactome : Nucleotide Excision Repair
Reactome : Polymerase switching
Reactome : Polymerase switching on the C-strand of the telomere
Reactome : Processive synthesis on the C-strand of the telomere
Reactome : Processive synthesis on the lagging strand
Reactome : Removal of DNA patch containing abasic residue
Reactome : Removal of the Flap Intermediate
Reactome : Removal of the Flap Intermediate from the C-strand
Reactome : Repair synthesis for gap-filling by DNA polymerase in TC-NER
Reactome : Repair synthesis of patch ~27-30 bases long by DNA polymerase
Reactome : Resolution of Abasic Sites (AP sites)
Reactome : Resolution of AP sites via the multiple-nucleotide patch replacement pathway
Reactome : S Phase
Reactome : Synthesis of DNA
Reactome : Telomere C-strand (Lagging Strand) Synthesis
Reactome : Telomere Maintenance
Reactome : Transcription-coupled NER (TC-NER)
WikiPathway : Cell cycle
WikiPathway : DNA Replication
WikiPathway : EGF/EGFR Signaling Pathway
WikiPathway : G1 to S cell cycle control
WikiPathway : Mismatch repair
WikiPathway : Nifedipine Activity


UniProt : P12004
HPRD : 01456


Cloning Information : 58411
HIP Master Clone ID : 38971
Original Clone ID : FLH058411.01X


TAX_ID : 9606
Species Specific ID: 5111


Chromosome : 20
Map Location : 20pter-p12
Ensembl : ENSG00000132646


Labome : PCNA-antibody