DNASU Plasmid Repository • 480.965.5697 | Email

TNF (Homo sapiens) in pDNR-Dual (Creator donor/master vector)

TOP

Explanation of Terms


Gene: Gene Symbol:  TNF
Gene Name:  tumor necrosis factor
Sequence              Map: pDNR-Dual_with_human_insert.pdf
Original Clone ID: FLH118283.01X
Keyword: None
Species: Homo sapiens
Type: cDNA
Vector Name: pDNR-Dual               Format:  CLOSED
Source: HIP
Description: None
Comments: None
Mutation/
Discrepancy :
No / Yes
Publications: PMID: 16512675
Title: Functional proteomics approach to investigate the biological activities of cDNAs implicated in breast cancer.
Authors: HIP
HsCD00001318

Price:  Login for Pricing
AVAILABLE
No restriction
Special MTA: None

 

Insert sequence: 702nts         Open reading frame : 1 to 702
Reference Sequence Alignment

ATGAGCACTGAAAGCATGATCCGGGACGTGGAGCTGGCCGAGGAGGCGCTCCCCAAGAAG
ACAGGGGGGCCCCAGGGCTCCAGGCGGTGCTTGTTCCTCAGCCTCTTCTCCTTCCTGATC
GTGGCAGGCGCCACCACGCTCTTCTGCCTGCTGCACTTTGGAGTGATCGGCCCCCAGAGG
GAAGAGTTCCCCAGGGACCTCTCTCTAATCAGCCCTCTGGCCCAGGCAGTCAGATCATCT
TCTCGAACCCCGAGTGACAAGCCTGTAGCCCATGTTGTAGCAAACCCTCAAGCTGAGGGG
CAGCTCCAGTGGCTGAACCGCCGGGCCAATGCCCTCCTGGCCAATGGCGTGGAGCTGAGA
GATAACCAGCTGGTGGTGCCATCAGAGGGCCTGTACCTCATCTACTCCCAGGTCCTCTTC
AAGGGCCAAGGCTGCCCCTCCACCCATGTGCTCCTCACCCACACCATCAGCCGCATCGCC
GTCTCCTACCAGACCAAGGTCAACCTCCTCTCTGCCATCAAGAGCCCCTGCCAGAGGGAG
ACCCCAGAGGGGGCTGAGGCCAAGCCCTGGTATGAGCCCATCTATCTGGGAGGGGTCTTC
CAGCTGGAGAAGGGTGACCGACTCAGCGCTGAGATCAATCGGCCCGACTATCTCGACTTT
GCCGAGTCTGGGCAGGTCTACTTTGGGATCATTGCCCTGTAG


Coding Sequence Details
Insert Sequence Verified?: Y Verification Method: Sequence Verification
Reference Sequence Annotations:
End on reference sequence 787
Start on reference sequence 86
Mutations:
None
Discrepancy:
c188t,S63F
                                

5' Linker Sequence:
5P GCGGCCGCATAACTTCGTATAGCATACATTATACGAAGTTATCAGTC
GACACC(ATG-GOI)

3' Linker Sequence:
5p (goi-stop)GGAAGCTTTCTAGACCATTCGTTTGGCGCGCGGGCCC

 

 Recommended Growth Condition:

Distributed in bacterial strain : DH5-alpha T1 phage resistant
Antibiotic Selection: Host Type:  bacterial    Marker:  ampicillin
Bacterial Selection Condition:  100 ug/mL ampicillin
Growth Condition:  Growth with the single antibiotic in LB at 37 degrees is recommended.
Comments:  Commonly used conditions for ampicillin resistant plasmid clones.
Protein Expression Results: None
Recommended expression in: Not Applicable
       DyNA Vector Map

         Powered by LabGenius

Vector Name: pDNR-Dual

pDNR-Dual in advanced viewed

Synonyms: None
Sequencing Primer: Forward:  M13F
Reverse:  Unknown
Description: Recombinational donor/master vector with 6xHN tag ORF, T7 and M13 primer sites; ampicillin resistance; restriction enzyme cloning (into) and recombinational cloning (from).
Comments: The position of features were detemined for the empty form of the vector, which is described in detail on the BD/Clontech website. Subcloning into the MCS was performed using the infusion reaction strategy and some restriction sites in the MCS may be lost after an insert is added.
Size (bp): 4938
Parent Vector: None
Empty Vector: None
Properties: Creator, donor (entry), loxP, multiple cloning site, recombinational cloning, with tag/fusion/marker
Author Name: BD Biosciences Clontech
Publications: None
Vector Map:         Vector Sequence:
Sequence:

 



Vector Features:

Type Name Description Start Position End Position
MCS MCS restriction enzyme-type multiple cloning site 45 129
bacterial origin ColE1 ColE1 (pUC-type) origin of replication 4111 4574
negative selection marker SacB SacB negative selection marker gene (sucrose sensitivity) 1057 2972
primer site M13 primer M13 primer sequencing site 4839 4855
primer site T7 primer T7 RNA Pol primer sequencing site 4865 4883
recombination site loxP site loxP recombination site 1015 1048
recombination site loxP site loxP recombination site 9 42
selectable marker CmR chloramphenicol resistance gene ORF (functional only after recombination of insert into vector with promoter) 986 327
selectable marker AmpR ampicillin resistance gene 3103 3963
splice donor site SD site splice donor site 132 136
tag HN 6xHN epitope tag 141 176

 

  • Gene
  • Pathways
  • Protein
  • Clone
  • Organism
  • Genome
  • Reagents

Gene

 

Gene Symbol : TNF
Symbol Nomenclature : TNF
SYNONYM : DIF; TNF-alpha; TNFA; TNFSF2
Designation : APC1 protein|TNF, macrophage-derived|TNF, monocyte-derived|TNF-a|cachectin|tumor necrosis factor ligand superfamily member 2|tumor necrosis factor-alpha
Full Nomenclature : tumor necrosis factor
GENEID : 7124
Locus Tag : DADB-70P7.1
GI : 61358333
GenBank Accession : AY888608
HGNC : 11892
MIM : 191160
Vega : OTTHUMG00000031194
Target GenBank: NM_000594

 

Reference Sequence Alignment

  

HsCD00001318      ATGAGCACTGAAAGCATGATCCGGGACGTGGAGCTGGCCGAGGAGGCGCTCCCCAAGAAG
NM_000594.3       ATGAGCACTGAAAGCATGATCCGGGACGTGGAGCTGGCCGAGGAGGCGCTCCCCAAGAAG
                  ************************************************************

HsCD00001318      ACAGGGGGGCCCCAGGGCTCCAGGCGGTGCTTGTTCCTCAGCCTCTTCTCCTTCCTGATC
NM_000594.3       ACAGGGGGGCCCCAGGGCTCCAGGCGGTGCTTGTTCCTCAGCCTCTTCTCCTTCCTGATC
                  ************************************************************

HsCD00001318      GTGGCAGGCGCCACCACGCTCTTCTGCCTGCTGCACTTTGGAGTGATCGGCCCCCAGAGG
NM_000594.3       GTGGCAGGCGCCACCACGCTCTTCTGCCTGCTGCACTTTGGAGTGATCGGCCCCCAGAGG
                  ************************************************************

HsCD00001318      GAAGAGTTCCCCAGGGACCTCTCTCTAATCAGCCCTCTGGCCCAGGCAGTCAGATCATCT
NM_000594.3       GAAGAGTTCCCCAGGGACCTCTCTCTAATCAGCCCTCTGGCCCAGGCAGTCAGATCATCT
                  ************************************************************

HsCD00001318      TCTCGAACCCCGAGTGACAAGCCTGTAGCCCATGTTGTAGCAAACCCTCAAGCTGAGGGG
NM_000594.3       TCTCGAACCCCGAGTGACAAGCCTGTAGCCCATGTTGTAGCAAACCCTCAAGCTGAGGGG
                  ************************************************************

HsCD00001318      CAGCTCCAGTGGCTGAACCGCCGGGCCAATGCCCTCCTGGCCAATGGCGTGGAGCTGAGA
NM_000594.3       CAGCTCCAGTGGCTGAACCGCCGGGCCAATGCCCTCCTGGCCAATGGCGTGGAGCTGAGA
                  ************************************************************

HsCD00001318      GATAACCAGCTGGTGGTGCCATCAGAGGGCCTGTACCTCATCTACTCCCAGGTCCTCTTC
NM_000594.3       GATAACCAGCTGGTGGTGCCATCAGAGGGCCTGTACCTCATCTACTCCCAGGTCCTCTTC
                  ************************************************************

HsCD00001318      AAGGGCCAAGGCTGCCCCTCCACCCATGTGCTCCTCACCCACACCATCAGCCGCATCGCC
NM_000594.3       AAGGGCCAAGGCTGCCCCTCCACCCATGTGCTCCTCACCCACACCATCAGCCGCATCGCC
                  ************************************************************

HsCD00001318      GTCTCCTACCAGACCAAGGTCAACCTCCTCTCTGCCATCAAGAGCCCCTGCCAGAGGGAG
NM_000594.3       GTCTCCTACCAGACCAAGGTCAACCTCCTCTCTGCCATCAAGAGCCCCTGCCAGAGGGAG
                  ************************************************************

HsCD00001318      ACCCCAGAGGGGGCTGAGGCCAAGCCCTGGTATGAGCCCATCTATCTGGGAGGGGTCTTC
NM_000594.3       ACCCCAGAGGGGGCTGAGGCCAAGCCCTGGTATGAGCCCATCTATCTGGGAGGGGTCTTC
                  ************************************************************

HsCD00001318      CAGCTGGAGAAGGGTGACCGACTCAGCGCTGAGATCAATCGGCCCGACTATCTCGACTTT
NM_000594.3       CAGCTGGAGAAGGGTGACCGACTCAGCGCTGAGATCAATCGGCCCGACTATCTCGACTTT
                  ************************************************************

HsCD00001318      GCCGAGTCTGGGCAGGTCTACTTTGGGATCATTGCCCTGTAG
NM_000594.3       GCCGAGTCTGGGCAGGTCTACTTTGGGATCATTGCCCTGTGA
                  ****************************************..

Pathways

NCI : Angiopoietin receptor Tie2-mediated signaling
NCI : Calcineurin-regulated NFAT-dependent transcription in lymphocytes
NCI : Canonical NF-kappaB pathway
NCI : Caspase Cascade in Apoptosis
NCI : Cellular roles of Anthrax toxin
NCI : Ceramide signaling pathway
NCI : Downstream signaling in naïve CD8+ T cells
NCI : HIV-1 Nef: Negative effector of Fas and TNF-alpha
NCI : IL23-mediated signaling events
NCI : IL27-mediated signaling events
NCI : RXR and RAR heterodimerization with other nuclear receptor
NCI : Signaling events mediated by HDAC Class I
NCI : TNF receptor signaling pathway
NCI : amb2 Integrin signaling
Panther : Apoptosis signaling pathway
Panther : Wnt signaling pathway
Reactome : Apoptosis
Reactome : Death Receptor Signalling
Reactome : Developmental Biology
Reactome : Extrinsic Pathway for Apoptosis
Reactome : TNF signaling
Reactome : Transcriptional regulation of white adipocyte differentiation
WikiPathway : Adipogenesis
WikiPathway : Alzheimers Disease
WikiPathway : Apoptosis
WikiPathway : Cytokines and Inflammatory Response
WikiPathway : EBV LMP1 signaling
WikiPathway : FAS pathway and Stress induction of HSP regulation
WikiPathway : Folate Metabolism
WikiPathway : MAPK signaling pathway
WikiPathway : Matrix Metalloproteinases
WikiPathway : MicroRNAs in cardiomyocyte hypertrophy
WikiPathway : Monoamine Transport
WikiPathway : Notch Signaling Pathway
WikiPathway : Regulation of toll-like receptor signaling pathway
WikiPathway : SIDS Susceptibility Pathways
WikiPathway : Selenium Pathway
WikiPathway : TGF Beta Signaling Pathway
WikiPathway : TNF alpha Signaling Pathway
WikiPathway : Toll-like receptor signaling pathway
WikiPathway : Type II diabetes mellitus
WikiPathway : Vitamin B12 Metabolism

Protein

SMART domain : TNF : Tumour necrosis factor family.
UniProt : P01375
UniProt : Q5STB3
UniProt : C1K3N5
HPRD : 01855

Clone

Cloning Information : 118283
HIP Master Clone ID : 94129
Original Clone ID : FLH118283.01X

Organism


TAX_ID : 9606
Species Specific ID: 7124

Genome

Chromosome : 6
Map Location : 6p21.3
Ensembl : ENSG00000232810

Reagents

Labome : TNF-alpha-antibody