DNASU Plasmid Repository • 480.965.5697 | Email

WNT5A (Homo sapiens) in pDNR-Dual (Creator donor/master vector)

TOP

Explanation of Terms


Gene: Gene Symbol:  WNT5A
Gene Name:  wingless-type MMTV integration site family, member 5A
Sequence              Map: pDNR-Dual_with_human_insert.pdf
Original Clone ID: FLH118314.01L
Keyword: None
Species: Homo sapiens
Type: cDNA
Vector Name: pDNR-Dual               Format:  FUSION
Source: HIP
Description: None
Comments: None
Mutation/
Discrepancy :
No / Yes
Publications: PMID: 16512675
Title: Functional proteomics approach to investigate the biological activities of cDNAs implicated in breast cancer.
Authors: HIP
HsCD00001343

Price:  Login for Pricing
AVAILABLE
No restriction
Special MTA: None

 

Insert sequence: 1098nts         Open reading frame : 1 to 1098
Reference Sequence Alignment

ATGGCTGGAAGTGCAATGTCTTCCAAGTTCTTCCTAGTGGCTTTGGCCATATTTTTCTCC
TTCGCCCAGGTTGTAATTGAAGCCAATTCTTGGTGGTCGCTAGGTATGAATAACCCTGTT
CAGATGTCAGAAGTATATATTATAGGAGCACAGCCTCTCTGCAGCCAACTGGCAGGACTT
TCTCAAGGACAGAAGAAACTGTGCCACTTGTATCAGGACCACATGCAGTACATCGGAGAA
GGCGCGAAGACAGGCATCAAAGAATGCCAGTATCAATTCCGACATCGAAGGTGGAACTGC
AGCACTGTGGATAACACCTCTGTTTTTGGCAGGGTGATGCAGATAGGCAGCCGCGAGACG
GCCTTCACATACGCGGTGAGCGCAGCAGGGGTGGTGAACGCCATGAGCCGGGCGTGCCGC
GAGGGCGAGCTGTCCACCTGCGGCTGCAGCCGCGCCGCGCGCCCCAAGGACCTGCCGCGG
GACTGGCTCTGGGGCGGCTGCGGCGACAACATCGACTATGGCTACCGCTTTGCCAAGGAG
TTCGTGGACGCCCGCGAGCGGGAGCGCATCCACGCCAAGGGCTCCTACGAGAGTGCTCGC
ATCCTCATGAACCTGCACAACAACGAGGCCGGCCGCAGGACGGTGTACAACCTGGCTGAT
GTGGCCTGCAAGTGCCATGGGGTGTCCGGCTCATGTAGCCTGAAGACATGCTGGCTGCAG
CTGGCAGACTTCCGCAAGGTGGGTGATGCCCTGAAGGAGAAGTACGACAGCGCGGCGGCC
ATGCGGCTCAACAGCCGGGGCAAGTTGGTACAGGTCAACAGCCGCTTCAACTCGCCCACC
ACACAAGACCTGGTCTACATCGACCCCAGCCCTGACTACTGCGTGCGCAATGAGAGCACC
GGCTCGCTGGGCACGCAGGGCCGCCTGTGCAACAAGACGTCGGAGGGCATGGATGGCTGC
GAGCTCATGTGCTGCGGCCGTGGCTACGACCAGTTCAAGACCGTGCAGACGGAGCGCTGC
CACTGCAAGTTCCACTGGTGCTGCTACGTCAAGTGCAAGAAGTGCACGGAGATCGTGGAC
CAGTTTGTGTGCAAGTTG


Coding Sequence Details
Insert Sequence Verified?: Y Verification Method: Sequence Verification
Reference Sequence Annotations:
End on reference sequence 1581
Start on reference sequence 484
Mutations:
None
Discrepancy:
c289a; c375g; g984c
                                

5' Linker Sequence:
5P GCGGCCGCATAACTTCGTATAGCATACATTATACGAAGTTATCAGTC
GACACC(ATG-GOI)

3' Linker Sequence:
5p (goi-stop)GGAAGCTTTCTAGACCATTCGTTTGGCGCGCGGGCCC

 

 Recommended Growth Condition:

Distributed in bacterial strain : DH5-alpha T1 phage resistant
Antibiotic Selection: Host Type:  bacterial    Marker:  ampicillin
Bacterial Selection Condition:  100 ug/mL ampicillin
Growth Condition:  Growth with the single antibiotic in LB at 37 degrees is recommended.
Comments:  Commonly used conditions for ampicillin resistant plasmid clones.
Protein Expression Results: None
Recommended expression in: Not Applicable
       DyNA Vector Map

         Powered by LabGenius

Vector Name: pDNR-Dual

pDNR-Dual in advanced viewed

Synonyms: None
Sequencing Primer: Forward:  M13F
Reverse:  Unknown
Description: Recombinational donor/master vector with 6xHN tag ORF, T7 and M13 primer sites; ampicillin resistance; restriction enzyme cloning (into) and recombinational cloning (from).
Comments: The position of features were detemined for the empty form of the vector, which is described in detail on the BD/Clontech website. Subcloning into the MCS was performed using the infusion reaction strategy and some restriction sites in the MCS may be lost after an insert is added.
Size (bp): 4938
Parent Vector: None
Empty Vector: None
Properties: Creator, donor (entry), loxP, multiple cloning site, recombinational cloning, with tag/fusion/marker
Author Name: BD Biosciences Clontech
Publications: None
Vector Map:         Vector Sequence:
Sequence:

 



Vector Features:

Type Name Description Start Position End Position
MCS MCS restriction enzyme-type multiple cloning site 45 129
bacterial origin ColE1 ColE1 (pUC-type) origin of replication 4111 4574
negative selection marker SacB SacB negative selection marker gene (sucrose sensitivity) 1057 2972
primer site M13 primer M13 primer sequencing site 4839 4855
primer site T7 primer T7 RNA Pol primer sequencing site 4865 4883
recombination site loxP site loxP recombination site 1015 1048
recombination site loxP site loxP recombination site 9 42
selectable marker CmR chloramphenicol resistance gene ORF (functional only after recombination of insert into vector with promoter) 986 327
selectable marker AmpR ampicillin resistance gene 3103 3963
splice donor site SD site splice donor site 132 136
tag HN 6xHN epitope tag 141 176

 

  • Gene
  • Pathways
  • Protein
  • Clone
  • Organism
  • Genome
  • Reagents

Gene

 

Gene Symbol : WNT5A
Symbol Nomenclature : WNT5A
SYNONYM : hWNT5A
Designation : WNT-5A protein|protein Wnt-5a
Full Nomenclature : wingless-type MMTV integration site family, member 5A
GENEID : 7474
GI : 61368469
GenBank Accession : AY891258
HGNC : 12784
MIM : 164975
Vega : OTTHUMG00000158361
Target GenBank: NM_003392

 

Reference Sequence Alignment

  

HsCD00001343        ---------------------------------------------ATGGCTGGAAGTGCA
NM_003392.4         ATGAAGAAGTCCATTGGAATATTAAGCCCAGGAGTTGCTTTGGGGATGGCTGGAAGTGCA
NM_001256105.1      ---------------------------------------------ATGGCTGGAAGTGCA
                                                                 ***************

HsCD00001343        ATGTCTTCCAAGTTCTTCCTAGTGGCTTTGGCCATATTTTTCTCCTTCGCCCAGGTTGTA
NM_003392.4         ATGTCTTCCAAGTTCTTCCTAGTGGCTTTGGCCATATTTTTCTCCTTCGCCCAGGTTGTA
NM_001256105.1      ATGTCTTCCAAGTTCTTCCTAGTGGCTTTGGCCATATTTTTCTCCTTCGCCCAGGTTGTA
                    ************************************************************

HsCD00001343        ATTGAAGCCAATTCTTGGTGGTCGCTAGGTATGAATAACCCTGTTCAGATGTCAGAAGTA
NM_003392.4         ATTGAAGCCAATTCTTGGTGGTCGCTAGGTATGAATAACCCTGTTCAGATGTCAGAAGTA
NM_001256105.1      ATTGAAGCCAATTCTTGGTGGTCGCTAGGTATGAATAACCCTGTTCAGATGTCAGAAGTA
                    ************************************************************

HsCD00001343        TATATTATAGGAGCACAGCCTCTCTGCAGCCAACTGGCAGGACTTTCTCAAGGACAGAAG
NM_003392.4         TATATTATAGGAGCACAGCCTCTCTGCAGCCAACTGGCAGGACTTTCTCAAGGACAGAAG
NM_001256105.1      TATATTATAGGAGCACAGCCTCTCTGCAGCCAACTGGCAGGACTTTCTCAAGGACAGAAG
                    ************************************************************

HsCD00001343        AAACTGTGCCACTTGTATCAGGACCACATGCAGTACATCGGAGAAGGCGCGAAGACAGGC
NM_003392.4         AAACTGTGCCACTTGTATCAGGACCACATGCAGTACATCGGAGAAGGCGCGAAGACAGGC
NM_001256105.1      AAACTGTGCCACTTGTATCAGGACCACATGCAGTACATCGGAGAAGGCGCGAAGACAGGC
                    ************************************************************

HsCD00001343        ATCAAAGAATGCCAGTATCAATTCCGACATCGAAGGTGGAACTGCAGCACTGTGGATAAC
NM_003392.4         ATCAAAGAATGCCAGTATCAATTCCGACATCGAAGGTGGAACTGCAGCACTGTGGATAAC
NM_001256105.1      ATCAAAGAATGCCAGTATCAATTCCGACATCGAAGGTGGAACTGCAGCACTGTGGATAAC
                    ************************************************************

HsCD00001343        ACCTCTGTTTTTGGCAGGGTGATGCAGATAGGCAGCCGCGAGACGGCCTTCACATACGCG
NM_003392.4         ACCTCTGTTTTTGGCAGGGTGATGCAGATAGGCAGCCGCGAGACGGCCTTCACATACGCG
NM_001256105.1      ACCTCTGTTTTTGGCAGGGTGATGCAGATAGGCAGCCGCGAGACGGCCTTCACATACGCG
                    ************************************************************

HsCD00001343        GTGAGCGCAGCAGGGGTGGTGAACGCCATGAGCCGGGCGTGCCGCGAGGGCGAGCTGTCC
NM_003392.4         GTGAGCGCAGCAGGGGTGGTGAACGCCATGAGCCGGGCGTGCCGCGAGGGCGAGCTGTCC
NM_001256105.1      GTGAGCGCAGCAGGGGTGGTGAACGCCATGAGCCGGGCGTGCCGCGAGGGCGAGCTGTCC
                    ************************************************************

HsCD00001343        ACCTGCGGCTGCAGCCGCGCCGCGCGCCCCAAGGACCTGCCGCGGGACTGGCTCTGGGGC
NM_003392.4         ACCTGCGGCTGCAGCCGCGCCGCGCGCCCCAAGGACCTGCCGCGGGACTGGCTCTGGGGC
NM_001256105.1      ACCTGCGGCTGCAGCCGCGCCGCGCGCCCCAAGGACCTGCCGCGGGACTGGCTCTGGGGC
                    ************************************************************

HsCD00001343        GGCTGCGGCGACAACATCGACTATGGCTACCGCTTTGCCAAGGAGTTCGTGGACGCCCGC
NM_003392.4         GGCTGCGGCGACAACATCGACTATGGCTACCGCTTTGCCAAGGAGTTCGTGGACGCCCGC
NM_001256105.1      GGCTGCGGCGACAACATCGACTATGGCTACCGCTTTGCCAAGGAGTTCGTGGACGCCCGC
                    ************************************************************

HsCD00001343        GAGCGGGAGCGCATCCACGCCAAGGGCTCCTACGAGAGTGCTCGCATCCTCATGAACCTG
NM_003392.4         GAGCGGGAGCGCATCCACGCCAAGGGCTCCTACGAGAGTGCTCGCATCCTCATGAACCTG
NM_001256105.1      GAGCGGGAGCGCATCCACGCCAAGGGCTCCTACGAGAGTGCTCGCATCCTCATGAACCTG
                    ************************************************************

HsCD00001343        CACAACAACGAGGCCGGCCGCAGGACGGTGTACAACCTGGCTGATGTGGCCTGCAAGTGC
NM_003392.4         CACAACAACGAGGCCGGCCGCAGGACGGTGTACAACCTGGCTGATGTGGCCTGCAAGTGC
NM_001256105.1      CACAACAACGAGGCCGGCCGCAGGACGGTGTACAACCTGGCTGATGTGGCCTGCAAGTGC
                    ************************************************************

HsCD00001343        CATGGGGTGTCCGGCTCATGTAGCCTGAAGACATGCTGGCTGCAGCTGGCAGACTTCCGC
NM_003392.4         CATGGGGTGTCCGGCTCATGTAGCCTGAAGACATGCTGGCTGCAGCTGGCAGACTTCCGC
NM_001256105.1      CATGGGGTGTCCGGCTCATGTAGCCTGAAGACATGCTGGCTGCAGCTGGCAGACTTCCGC
                    ************************************************************

HsCD00001343        AAGGTGGGTGATGCCCTGAAGGAGAAGTACGACAGCGCGGCGGCCATGCGGCTCAACAGC
NM_003392.4         AAGGTGGGTGATGCCCTGAAGGAGAAGTACGACAGCGCGGCGGCCATGCGGCTCAACAGC
NM_001256105.1      AAGGTGGGTGATGCCCTGAAGGAGAAGTACGACAGCGCGGCGGCCATGCGGCTCAACAGC
                    ************************************************************

HsCD00001343        CGGGGCAAGTTGGTACAGGTCAACAGCCGCTTCAACTCGCCCACCACACAAGACCTGGTC
NM_003392.4         CGGGGCAAGTTGGTACAGGTCAACAGCCGCTTCAACTCGCCCACCACACAAGACCTGGTC
NM_001256105.1      CGGGGCAAGTTGGTACAGGTCAACAGCCGCTTCAACTCGCCCACCACACAAGACCTGGTC
                    ************************************************************

HsCD00001343        TACATCGACCCCAGCCCTGACTACTGCGTGCGCAATGAGAGCACCGGCTCGCTGGGCACG
NM_003392.4         TACATCGACCCCAGCCCTGACTACTGCGTGCGCAATGAGAGCACCGGCTCGCTGGGCACG
NM_001256105.1      TACATCGACCCCAGCCCTGACTACTGCGTGCGCAATGAGAGCACCGGCTCGCTGGGCACG
                    ************************************************************

HsCD00001343        CAGGGCCGCCTGTGCAACAAGACGTCGGAGGGCATGGATGGCTGCGAGCTCATGTGCTGC
NM_003392.4         CAGGGCCGCCTGTGCAACAAGACGTCGGAGGGCATGGATGGCTGCGAGCTCATGTGCTGC
NM_001256105.1      CAGGGCCGCCTGTGCAACAAGACGTCGGAGGGCATGGATGGCTGCGAGCTCATGTGCTGC
                    ************************************************************

HsCD00001343        GGCCGTGGCTACGACCAGTTCAAGACCGTGCAGACGGAGCGCTGCCACTGCAAGTTCCAC
NM_003392.4         GGCCGTGGCTACGACCAGTTCAAGACCGTGCAGACGGAGCGCTGCCACTGCAAGTTCCAC
NM_001256105.1      GGCCGTGGCTACGACCAGTTCAAGACCGTGCAGACGGAGCGCTGCCACTGCAAGTTCCAC
                    ************************************************************

HsCD00001343        TGGTGCTGCTACGTCAAGTGCAAGAAGTGCACGGAGATCGTGGACCAGTTTGTGTGCAAG
NM_003392.4         TGGTGCTGCTACGTCAAGTGCAAGAAGTGCACGGAGATCGTGGACCAGTTTGTGTGCAAG
NM_001256105.1      TGGTGCTGCTACGTCAAGTGCAAGAAGTGCACGGAGATCGTGGACCAGTTTGTGTGCAAG
                    ************************************************************

HsCD00001343        TTG
NM_003392.4         TAG
NM_001256105.1      TAG
                    *:*

Pathways

NCI : Noncanonical Wnt signaling pathway
NCI : Validated targets of C-MYC transcriptional repression
NCI : Wnt signaling network
Panther : Alzheimer disease-presenilin pathway
Panther : Angiogenesis
Panther : Cadherin signaling pathway
Panther : Wnt signaling pathway
Reactome : Asymmetric localization of PCP proteins
Reactome : Ca2+ pathway
Reactome : Class B/2 (Secretin family receptors)
Reactome : GPCR ligand binding
Reactome : PCP/CE pathway
Reactome : Signal Transduction
Reactome : Signaling by GPCR
Reactome : Signaling by Wnt
Reactome : TCF dependent signaling in response to WNT
Reactome : WNT ligand biogenesis and trafficking
Reactome : WNT5A-dependent internalization of FZD2, FZD5 and ROR2
Reactome : WNT5A-dependent internalization of FZD4
Reactome : beta-catenin independent WNT signaling
Reactome : negative regulation of TCF-dependent signaling by WNT ligand antagonists
WikiPathway : DNA damage response (only ATM dependent)
WikiPathway : Epithelium TarBase
WikiPathway : Lymphocyte TarBase
WikiPathway : MicroRNAs in cardiomyocyte hypertrophy
WikiPathway : Muscle cell TarBase
WikiPathway : Wnt Signaling Pathway
WikiPathway : Wnt Signaling Pathway and Pluripotency

Protein

SMART domain : WNT1 : found in Wnt-1
UniProt : P41221
HPRD : 01293

Clone

Cloning Information : 118314
HIP Master Clone ID : 94160
Original Clone ID : FLH118314.01L

Organism


TAX_ID : 9606
Species Specific ID: 7474

Genome

Chromosome : 3
Map Location : 3p21-p14
Ensembl : ENSG00000114251

Reagents

Labome : WNT5A-antibody