DNASU Plasmid Repository • 480.965.5697 | Email

MAP2K4 (Homo sapiens) in pDNR-Dual (Creator donor/master vector)

TOP

Explanation of Terms


Gene: Gene Symbol:  MAP2K4
Gene Name:  mitogen-activated protein kinase kinase 4
Sequence              Map: pDNR-Dual_with_human_insert.pdf
Original Clone ID: FLH019035.01X
Keyword: None
Species: Homo sapiens
Type: cDNA
Vector Name: pDNR-Dual               Format:  CLOSED
Source: HIP
Description: None
Comments: None
Mutation/
Discrepancy :
No / No
Publications: PMID: 16512675
Title: Functional proteomics approach to investigate the biological activities of cDNAs implicated in breast cancer.
PMID: 15928075
Title: Building a human kinase gene repository: bioinformatics, molecular cloning, and functional validation.
Authors: HIP
HsCD00000139

Price:  Login for Pricing
AVAILABLE
No restriction
Special MTA: None

 

Insert sequence: 1200nts         Open reading frame : 1 to 1200
Reference Sequence Alignment

ATGGCGGCTCCGAGCCCGAGCGGCGGCGGCGGCTCCGGGGGCGGCAGCGGCAGCGGCACC
CCCGGCCCCGTAGGGTCCCCGGCGCCAGGCCACCCGGCCGTCAGCAGCATGCAGGGTAAA
CGCAAAGCACTGAAGTTGAATTTTGCAAATCCACCTTTCAAATCTACAGCAAGGTTTACT
CTGAATCCCAATCCTACAGGAGTTCAAAACCCACACATAGAGAGACTGAGAACACACAGC
ATTGAGTCATCAGGAAAACTGAAGATCTCCCCTGAACAACACTGGGATTTCACTGCAGAG
GACTTGAAAGACCTTGGAGAAATTGGACGAGGAGCTTATGGTTCTGTCAACAAAATGGTC
CACAAACCAAGTGGGCAAATAATGGCAGTTAAAAGAATTCGGTCAACAGTGGATGAAAAA
GAACAAAAACAACTTCTTATGGATTTGGATGTAGTAATGCGGAGTAGTGATTGCCCATAC
ATTGTTCAGTTTTATGGTGCACTCTTCAGAGAGGGTGACTGTTGGATCTGTATGGAACTC
ATGTCTACCTCGTTTGATAAGTTTTACAAATATGTATATAGTGTATTAGATGATGTTATT
CCAGAAGAAATTTTAGGCAAAATCACTTTAGCAACTGTGAAAGCACTAAACCACTTAAAA
GAAAACTTGAAAATTATTCACAGAGATATCAAACCTTCCAATATTCTTCTGGACAGAAGT
GGAAATATTAAGCTCTGTGACTTCGGCATCAGTGGACAGCTTGTGGACTCTATTGCCAAG
ACAAGAGATGCTGGCTGTAGGCCATACATGGCACCTGAAAGAATAGACCCAAGCGCATCA
CGACAAGGATATGATGTCCGCTCTGATGTCTGGAGTTTGGGGATCACATTGTATGAGTTG
GCCACAGGCCGATTTCCTTATCCAAAGTGGAATAGTGTATTTGATCAACTAACACAAGTC
GTGAAAGGAGATCCTCCGCAGCTGAGTAATTCTGAGGAAAGGGAATTCTCCCCGAGTTTC
ATCAACTTTGTCAACTTGTGCCTTACGAAGGATGAATCCAAAAGGCCAAAGTATAAAGAG
CTTCTGAAACATCCCTTTATTTTGATGTATGAAGAACGTGCCGTTGAGGTCGCATGCTAT
GTTTGTAAAATCCTGGATCAAATGCCAGCTACTCCCAGCTCTCCCATGTATGTCGATTGA


Coding Sequence Details
Insert Sequence Verified?: Y Verification Method: Sequence Verification
Reference Sequence Annotations:
End on reference sequence 1209
Start on reference sequence 10
Mutations:
None
Discrepancy:
None
5' Linker Sequence:
5P GCGGCCGCATAACTTCGTATAGCATACATTATACGAAGTTATCAGTC
GACACC(ATG-GOI)

3' Linker Sequence:
5p (goi-stop)GGAAGCTTTCTAGACCATTCGTTTGGCGCGCGGGCCC

 

 Recommended Growth Condition:

Distributed in bacterial strain : DH5-alpha T1 phage resistant
Antibiotic Selection: Host Type:  bacterial    Marker:  ampicillin
Bacterial Selection Condition:  100 ug/mL ampicillin
Growth Condition:  Growth with the single antibiotic in LB at 37 degrees is recommended.
Comments:  Commonly used conditions for ampicillin resistant plasmid clones.
Protein Expression Results: None
Recommended expression in: Not Applicable
       DyNA Vector Map

         Powered by LabGenius

Vector Name: pDNR-Dual

pDNR-Dual in advanced viewed

Synonyms: None
Sequencing Primer: Forward:  M13F
Reverse:  Unknown
Description: Recombinational donor/master vector with 6xHN tag ORF, T7 and M13 primer sites; ampicillin resistance; restriction enzyme cloning (into) and recombinational cloning (from).
Comments: The position of features were detemined for the empty form of the vector, which is described in detail on the BD/Clontech website. Subcloning into the MCS was performed using the infusion reaction strategy and some restriction sites in the MCS may be lost after an insert is added.
Size (bp): 4938
Parent Vector: None
Empty Vector: None
Properties: Creator, donor (entry), loxP, multiple cloning site, recombinational cloning, with tag/fusion/marker
Author Name: BD Biosciences Clontech
Publications: None
Vector Map:         Vector Sequence:
Sequence:

 



Vector Features:

Type Name Description Start Position End Position
MCS MCS restriction enzyme-type multiple cloning site 45 129
bacterial origin ColE1 ColE1 (pUC-type) origin of replication 4111 4574
negative selection marker SacB SacB negative selection marker gene (sucrose sensitivity) 1057 2972
primer site M13 primer M13 primer sequencing site 4839 4855
primer site T7 primer T7 RNA Pol primer sequencing site 4865 4883
recombination site loxP site loxP recombination site 1015 1048
recombination site loxP site loxP recombination site 9 42
selectable marker CmR chloramphenicol resistance gene ORF (functional only after recombination of insert into vector with promoter) 986 327
selectable marker AmpR ampicillin resistance gene 3103 3963
splice donor site SD site splice donor site 132 136
tag HN 6xHN epitope tag 141 176

 

  • Gene
  • Pathways
  • Protein
  • Clone
  • Organism
  • Genome
  • Reagents

Gene

 

Gene Symbol : MAP2K4
Symbol Nomenclature : MAP2K4
SYNONYM : JNKK; JNKK1; MAPKK4; MEK4; MKK4; PRKMK4; SAPKK-1; SAPKK1; SEK1; SERK1; SKK1
Designation : JNK activating kinase 1|JNK-activated kinase 1|JNK-activating kinase 1|MAP kinase kinase 4|MAPK/ERK kinase 4|MAPKK 4|MEK 4|SAPK/ERK kinase 1|c-Jun N-terminal kinase kinase 1|dual specificity mitogen-activated protein kinase kinase 4|stress-activated protein kinase kinase 1
Full Nomenclature : mitogen-activated protein kinase kinase 4
GENEID : 6416
GI : 61354992
GenBank Accession : AY888139
HGNC : 6844
MIM : 601335
Vega : OTTHUMG00000178267
Target GenBank: NM_003010

 

Reference Sequence Alignment

  

HsCD00000139        ATGGCGGCTCCGAGCCCGAGCGGCGGCGGCGGCTCCGGGGGCGGCAGCGGCAGCGGCACC
NM_003010.3         ATGGCGGCTCCGAGCCCGAGCGGCGGCGGCGGCTCCGGGGGCGGCAGCGGCAGCGGCACC
NM_001281435.1      ATGGCGGCTCCGAGCCCGAGCGGCGGCGGCGGCTCCGGGGGCGGCAGCGGCAGCGGCACC
                    ************************************************************

HsCD00000139        CCCGGCCCCGTAGGGTCCCCGGCGCCAGGCCACCCGGCCGTCAGCAGCATGCAGG-----
NM_003010.3         CCCGGCCCCGTAGGGTCCCCGGCGCCAGGCCACCCGGCCGTCAGCAGCATGCAGG-----
NM_001281435.1      CCCGGCCCCGTAGGGTCCCCGGCGCCAGGCCACCCGGCCGTCAGCAGCATGCAGGGCTTT
                    *******************************************************     

HsCD00000139        ----------------------------GTAAACGCAAAGCACTGAAGTTGAATTTTGCA
NM_003010.3         ----------------------------GTAAACGCAAAGCACTGAAGTTGAATTTTGCA
NM_001281435.1      CAGATAAACTTCTGTGAAAAGGCACAAAGTAAACGCAAAGCACTGAAGTTGAATTTTGCA
                                                ********************************

HsCD00000139        AATCCACCTTTCAAATCTACAGCAAGGTTTACTCTGAATCCCAATCCTACAGGAGTTCAA
NM_003010.3         AATCCACCTTTCAAATCTACAGCAAGGTTTACTCTGAATCCCAATCCTACAGGAGTTCAA
NM_001281435.1      AATCCACCTTTCAAATCTACAGCAAGGTTTACTCTGAATCCCAATCCTACAGGAGTTCAA
                    ************************************************************

HsCD00000139        AACCCACACATAGAGAGACTGAGAACACACAGCATTGAGTCATCAGGAAAACTGAAGATC
NM_003010.3         AACCCACACATAGAGAGACTGAGAACACACAGCATTGAGTCATCAGGAAAACTGAAGATC
NM_001281435.1      AACCCACACATAGAGAGACTGAGAACACACAGCATTGAGTCATCAGGAAAACTGAAGATC
                    ************************************************************

HsCD00000139        TCCCCTGAACAACACTGGGATTTCACTGCAGAGGACTTGAAAGACCTTGGAGAAATTGGA
NM_003010.3         TCCCCTGAACAACACTGGGATTTCACTGCAGAGGACTTGAAAGACCTTGGAGAAATTGGA
NM_001281435.1      TCCCCTGAACAACACTGGGATTTCACTGCAGAGGACTTGAAAGACCTTGGAGAAATTGGA
                    ************************************************************

HsCD00000139        CGAGGAGCTTATGGTTCTGTCAACAAAATGGTCCACAAACCAAGTGGGCAAATAATGGCA
NM_003010.3         CGAGGAGCTTATGGTTCTGTCAACAAAATGGTCCACAAACCAAGTGGGCAAATAATGGCA
NM_001281435.1      CGAGGAGCTTATGGTTCTGTCAACAAAATGGTCCACAAACCAAGTGGGCAAATAATGGCA
                    ************************************************************

HsCD00000139        GTTAAAAGAATTCGGTCAACAGTGGATGAAAAAGAACAAAAACAACTTCTTATGGATTTG
NM_003010.3         GTTAAAAGAATTCGGTCAACAGTGGATGAAAAAGAACAAAAACAACTTCTTATGGATTTG
NM_001281435.1      GTTAAAAGAATTCGGTCAACAGTGGATGAAAAAGAACAAAAACAACTTCTTATGGATTTG
                    ************************************************************

HsCD00000139        GATGTAGTAATGCGGAGTAGTGATTGCCCATACATTGTTCAGTTTTATGGTGCACTCTTC
NM_003010.3         GATGTAGTAATGCGGAGTAGTGATTGCCCATACATTGTTCAGTTTTATGGTGCACTCTTC
NM_001281435.1      GATGTAGTAATGCGGAGTAGTGATTGCCCATACATTGTTCAGTTTTATGGTGCACTCTTC
                    ************************************************************

HsCD00000139        AGAGAGGGTGACTGTTGGATCTGTATGGAACTCATGTCTACCTCGTTTGATAAGTTTTAC
NM_003010.3         AGAGAGGGTGACTGTTGGATCTGTATGGAACTCATGTCTACCTCGTTTGATAAGTTTTAC
NM_001281435.1      AGAGAGGGTGACTGTTGGATCTGTATGGAACTCATGTCTACCTCGTTTGATAAGTTTTAC
                    ************************************************************

HsCD00000139        AAATATGTATATAGTGTATTAGATGATGTTATTCCAGAAGAAATTTTAGGCAAAATCACT
NM_003010.3         AAATATGTATATAGTGTATTAGATGATGTTATTCCAGAAGAAATTTTAGGCAAAATCACT
NM_001281435.1      AAATATGTATATAGTGTATTAGATGATGTTATTCCAGAAGAAATTTTAGGCAAAATCACT
                    ************************************************************

HsCD00000139        TTAGCAACTGTGAAAGCACTAAACCACTTAAAAGAAAACTTGAAAATTATTCACAGAGAT
NM_003010.3         TTAGCAACTGTGAAAGCACTAAACCACTTAAAAGAAAACTTGAAAATTATTCACAGAGAT
NM_001281435.1      TTAGCAACTGTGAAAGCACTAAACCACTTAAAAGAAAACTTGAAAATTATTCACAGAGAT
                    ************************************************************

HsCD00000139        ATCAAACCTTCCAATATTCTTCTGGACAGAAGTGGAAATATTAAGCTCTGTGACTTCGGC
NM_003010.3         ATCAAACCTTCCAATATTCTTCTGGACAGAAGTGGAAATATTAAGCTCTGTGACTTCGGC
NM_001281435.1      ATCAAACCTTCCAATATTCTTCTGGACAGAAGTGGAAATATTAAGCTCTGTGACTTCGGC
                    ************************************************************

HsCD00000139        ATCAGTGGACAGCTTGTGGACTCTATTGCCAAGACAAGAGATGCTGGCTGTAGGCCATAC
NM_003010.3         ATCAGTGGACAGCTTGTGGACTCTATTGCCAAGACAAGAGATGCTGGCTGTAGGCCATAC
NM_001281435.1      ATCAGTGGACAGCTTGTGGACTCTATTGCCAAGACAAGAGATGCTGGCTGTAGGCCATAC
                    ************************************************************

HsCD00000139        ATGGCACCTGAAAGAATAGACCCAAGCGCATCACGACAAGGATATGATGTCCGCTCTGAT
NM_003010.3         ATGGCACCTGAAAGAATAGACCCAAGCGCATCACGACAAGGATATGATGTCCGCTCTGAT
NM_001281435.1      ATGGCACCTGAAAGAATAGACCCAAGCGCATCACGACAAGGATATGATGTCCGCTCTGAT
                    ************************************************************

HsCD00000139        GTCTGGAGTTTGGGGATCACATTGTATGAGTTGGCCACAGGCCGATTTCCTTATCCAAAG
NM_003010.3         GTCTGGAGTTTGGGGATCACATTGTATGAGTTGGCCACAGGCCGATTTCCTTATCCAAAG
NM_001281435.1      GTCTGGAGTTTGGGGATCACATTGTATGAGTTGGCCACAGGCCGATTTCCTTATCCAAAG
                    ************************************************************

HsCD00000139        TGGAATAGTGTATTTGATCAACTAACACAAGTCGTGAAAGGAGATCCTCCGCAGCTGAGT
NM_003010.3         TGGAATAGTGTATTTGATCAACTAACACAAGTCGTGAAAGGAGATCCTCCGCAGCTGAGT
NM_001281435.1      TGGAATAGTGTATTTGATCAACTAACACAAGTCGTGAAAGGAGATCCTCCGCAGCTGAGT
                    ************************************************************

HsCD00000139        AATTCTGAGGAAAGGGAATTCTCCCCGAGTTTCATCAACTTTGTCAACTTGTGCCTTACG
NM_003010.3         AATTCTGAGGAAAGGGAATTCTCCCCGAGTTTCATCAACTTTGTCAACTTGTGCCTTACG
NM_001281435.1      AATTCTGAGGAAAGGGAATTCTCCCCGAGTTTCATCAACTTTGTCAACTTGTGCCTTACG
                    ************************************************************

HsCD00000139        AAGGATGAATCCAAAAGGCCAAAGTATAAAGAGCTTCTGAAACATCCCTTTATTTTGATG
NM_003010.3         AAGGATGAATCCAAAAGGCCAAAGTATAAAGAGCTTCTGAAACATCCCTTTATTTTGATG
NM_001281435.1      AAGGATGAATCCAAAAGGCCAAAGTATAAAGAGCTTCTGAAACATCCCTTTATTTTGATG
                    ************************************************************

HsCD00000139        TATGAAGAACGTGCCGTTGAGGTCGCATGCTATGTTTGTAAAATCCTGGATCAAATGCCA
NM_003010.3         TATGAAGAACGTGCCGTTGAGGTCGCATGCTATGTTTGTAAAATCCTGGATCAAATGCCA
NM_001281435.1      TATGAAGAACGTGCCGTTGAGGTCGCATGCTATGTTTGTAAAATCCTGGATCAAATGCCA
                    ************************************************************

HsCD00000139        GCTACTCCCAGCTCTCCCATGTATGTCGATTGA
NM_003010.3         GCTACTCCCAGCTCTCCCATGTATGTCGATTGA
NM_001281435.1      GCTACTCCCAGCTCTCCCATGTATGTCGATTGA
                    *********************************

Pathways

NCI : CD40/CD40L signaling
NCI : CDC42 signaling events
NCI : Cellular roles of Anthrax toxin
NCI : Ceramide signaling pathway
NCI : Ephrin B reverse signaling
NCI : ErbB1 downstream signaling
NCI : Fc-epsilon receptor I signaling in mast cells
NCI : IL6-mediated signaling events
NCI : JNK signaling in the CD4+ TCR pathway
NCI : Nephrin/Neph1 signaling in the kidney podocyte
NCI : PDGFR-beta signaling pathway
NCI : RAC1 signaling pathway
NCI : Regulation of Androgen receptor activity
NCI : Regulation of p38-alpha and p38-beta
NCI : RhoA signaling pathway
NCI : Signaling events mediated by Hepatocyte Growth Factor Receptor (c-Met)
NCI : Signaling events mediated by focal adhesion kinase
NCI : TRAIL signaling pathway
NCI : VEGFR3 signaling in lymphatic endothelium
Panther : Angiogenesis
Panther : Apoptosis signaling pathway
Panther : EGF receptor signaling pathway
Panther : FAS signaling pathway
Panther : FGF signaling pathway
Panther : Huntington disease
Panther : Integrin signalling pathway
Panther : Oxidative stress response
Panther : Ras Pathway
Panther : p38 MAPK pathway
Reactome : Activated TLR4 signalling
Reactome : Cellular Senescence
Reactome : Cellular responses to stress
Reactome : Cytokine Signaling in Immune system
Reactome : FCERI mediated MAPK activation
Reactome : Fc epsilon receptor (FCERI) signaling
Reactome : Immune System
Reactome : Innate Immune System
Reactome : Interleukin-1 signaling
Reactome : JNK (c-Jun kinases) phosphorylation and activation mediated by activated human TAK1
Reactome : MAP kinase activation in TLR cascade
Reactome : MyD88 cascade initiated on plasma membrane
Reactome : MyD88 dependent cascade initiated on endosome
Reactome : MyD88-independent cascade
Reactome : MyD88:Mal cascade initiated on plasma membrane
Reactome : Oxidative Stress Induced Senescence
Reactome : Signaling by Interleukins
Reactome : TRAF6 Mediated Induction of proinflammatory cytokines
Reactome : TRAF6 mediated induction of NFkB and MAP kinases upon TLR7/8 or 9 activation
Reactome : TRIF-mediated TLR3/TLR4 signaling
Reactome : Toll Like Receptor 10 (TLR10) Cascade
Reactome : Toll Like Receptor 2 (TLR2) Cascade
Reactome : Toll Like Receptor 3 (TLR3) Cascade
Reactome : Toll Like Receptor 4 (TLR4) Cascade
Reactome : Toll Like Receptor 5 (TLR5) Cascade
Reactome : Toll Like Receptor 7/8 (TLR7/8) Cascade
Reactome : Toll Like Receptor 9 (TLR9) Cascade
Reactome : Toll Like Receptor TLR1:TLR2 Cascade
Reactome : Toll Like Receptor TLR6:TLR2 Cascade
Reactome : Toll-Like Receptors Cascades
WikiPathway : Apoptosis
WikiPathway : FAS pathway and Stress induction of HSP regulation
WikiPathway : IL-1 signaling pathway
WikiPathway : IL-6 signaling pathway
WikiPathway : Insulin Signaling
WikiPathway : MAPK Cascade
WikiPathway : MAPK signaling pathway
WikiPathway : MicroRNAs in cardiomyocyte hypertrophy
WikiPathway : Regulation of toll-like receptor signaling pathway
WikiPathway : TGF beta Signaling Pathway
WikiPathway : TNF alpha Signaling Pathway
WikiPathway : Toll-like receptor signaling pathway
WikiPathway : angiogenesis overview
WikiPathway : p38 MAPK Signaling Pathway

Clone

Cloning Information : 19035
HIP Master Clone ID : 33234
Original Clone ID : FLH019035.01X

Organism


TAX_ID : 9606
Species Specific ID: 6416

Genome

Chromosome : 17
Map Location : 17p12
Ensembl : ENSG00000065559

Reagents

Labome : MKK4-antibody