DNASU Plasmid Repository • 480.965.5697 | Email

AKT3 (Homo sapiens) in pDNR-Dual (Creator donor/master vector)

TOP

Explanation of Terms


Gene: Gene Symbol:  AKT3
Gene Name:  v-akt murine thymoma viral oncogene homolog 3
Sequence              Map: pDNR-Dual_with_human_insert.pdf
Original Clone ID: FLH000146.01L
Keyword: None
Species: Homo sapiens
Type: cDNA
Vector Name: pDNR-Dual               Format:  FUSION
Source: HIP
Description: None
Comments: None
Mutation/
Discrepancy :
No / Yes
Publications: PMID: 16512675
Title: Functional proteomics approach to investigate the biological activities of cDNAs implicated in breast cancer.
PMID: 15928075
Title: Building a human kinase gene repository: bioinformatics, molecular cloning, and functional validation.
Authors: HIP
HsCD00001396

Price:  Login for Pricing
AVAILABLE
No restriction
Special MTA: None

 

Insert sequence: 1440nts         Open reading frame : 1 to 1440
Reference Sequence Alignment

ATGAGCGATGTTACCATTGTGAAAGAAGGTTGGGTTCAGAAGAGGGGAGAATATATAAAA
AACTGGAGGCCAAGATACTTCCTTTTGAAGACAGATGGCTCATTCATAGGATATAAAGAG
AAACCTCAAGATGTGGATTTACCTTATCCCCTCAACAACTTTTCAGTGGCAAAATGCCAG
TTAATGAAAACAGAACGACCAAAGCCAAACACATTTATAATCAGATGTCTCCAGTGGACT
ACTGTTATAGAGAGAACATTTCATGTAGATACTCCAGAGGAAAGGGAAGAATGGACAGAA
GCTATCCAGGCTGTAGCAGACAGACTGCAGAGGCAAGAAGAGGAGAGAATGAATTGTAGT
CCAACTTCACAAATTGATAATATAGGAGAGGAAGAGATGGATGCCTCTACAACCCATCAT
AAAAGAAAGACAATGAATGATTTTGACTATTTGAAACTACTAGGTAAAGGCACTTTTGGG
AAAGTTATTTTGGTTCGAGAGAAGGCAAGTGGAAAATACTATGCTATGAAGATTCTGAAG
AAAGAAGTCATTATTGCAAAGGATGAAGTGGCACACACTCTAACTGAAAGCAGAGTATTA
AAGAACACTAGACATCCCTTTTTAACATCCTTGAAATATTCCTTCCAGACAAAAGACCGT
TTGTGTTTTGTGATGGAATATGTTAATGGGGGCGAGCTGTTTTTCCATTTGTCGAGAGAG
CGGGTGTTCTCTGAGGACCGCACACGTTTCTATGGTGCAGAAATTGTCTCTGCCTTGGAC
TATCTACATTCCGGAAAGATTGTGTACCGTGATCTCAAGTTGGAGAATCTAATGCTGGAC
AAAGATGGCCACATAAAAATTACAGATTTTGGACTTTGCAAAGAAGGGATCACAGATGCA
GCCACCATGAAGACATTCTGTGGCACTCCAGAATATCTGGCACCAGAGGTGTTAGAAGAT
AATGACTATGGCCGAGCAGTAGACTGGTGGGGCCTAGGGGTTGTCATGTATGAAATGATG
TGTGGGAGGTTACCTTTCTACAACCAGGACCATGAGAAACTTTTTGAATTAATATTAATG
GAAGACATTAAATTTCCTCGAACACTCTCTTCAGATGCAAAATCATTGCTTTCAGGGCTC
TTGATAAAGGATCCAAATAAACGCCTTGGTGGAGGACCAGATGATGCAAAAGAAATTATG
AGACACAGTTTCTTCTCTGGAGTAAACTGGCAAGATGTATATGATAAAAAGCTTGTACCT
CCTTTTAAACCTCAAGTAACATCTGAGACAGATACTAGATATTTTGATGAAGAATTTACA
GCTCAGACTATTACAATAACACCACCTGAAAAATATGATGAGGATGGTATGGACTGCATG
GACAATGAGAGGCGGCCGCATTTCCCTCAATTTTCCTACTCTGCAAGTGGACGAGAATTG


Coding Sequence Details
Insert Sequence Verified?: Y Verification Method: Sequence Verification
Reference Sequence Annotations:
End on reference sequence 1452
Start on reference sequence 13
Mutations:
None
Discrepancy:
g24a
                                

5' Linker Sequence:
5P GCGGCCGCATAACTTCGTATAGCATACATTATACGAAGTTATCAGTC
GACACC(ATG-GOI)

3' Linker Sequence:
5p (goi-stop)GGAAGCTTTCTAGACCATTCGTTTGGCGCGCGGGCCC

 

 Recommended Growth Condition:

Distributed in bacterial strain : DH5-alpha T1 phage resistant
Antibiotic Selection: Host Type:  bacterial    Marker:  ampicillin
Bacterial Selection Condition:  100 ug/mL ampicillin
Growth Condition:  Growth with the single antibiotic in LB at 37 degrees is recommended.
Comments:  Commonly used conditions for ampicillin resistant plasmid clones.
Protein Expression Results: None
Recommended expression in: Not Applicable
       DyNA Vector Map

         Powered by LabGenius

Vector Name: pDNR-Dual

pDNR-Dual in advanced viewed

Synonyms: None
Sequencing Primer: Forward:  M13F
Reverse:  Unknown
Description: Recombinational donor/master vector with 6xHN tag ORF, T7 and M13 primer sites; ampicillin resistance; restriction enzyme cloning (into) and recombinational cloning (from).
Comments: The position of features were detemined for the empty form of the vector, which is described in detail on the BD/Clontech website. Subcloning into the MCS was performed using the infusion reaction strategy and some restriction sites in the MCS may be lost after an insert is added.
Size (bp): 4938
Parent Vector: None
Empty Vector: None
Properties: Creator, donor (entry), loxP, multiple cloning site, recombinational cloning, with tag/fusion/marker
Author Name: BD Biosciences Clontech
Publications: None
Vector Map:         Vector Sequence:
Sequence:

 



Vector Features:

Type Name Description Start Position End Position
MCS MCS restriction enzyme-type multiple cloning site 45 129
bacterial origin ColE1 ColE1 (pUC-type) origin of replication 4111 4574
negative selection marker SacB SacB negative selection marker gene (sucrose sensitivity) 1057 2972
primer site M13 primer M13 primer sequencing site 4839 4855
primer site T7 primer T7 RNA Pol primer sequencing site 4865 4883
recombination site loxP site loxP recombination site 1015 1048
recombination site loxP site loxP recombination site 9 42
selectable marker CmR chloramphenicol resistance gene ORF (functional only after recombination of insert into vector with promoter) 986 327
selectable marker AmpR ampicillin resistance gene 3103 3963
splice donor site SD site splice donor site 132 136
tag HN 6xHN epitope tag 141 176

 

  • Gene
  • Pathways
  • Protein
  • Clone
  • Organism
  • Genome
  • Reagents

Gene

 

Gene Symbol : AKT3
Symbol Nomenclature : AKT3
SYNONYM : MPPH; PKB-GAMMA; PKBG; PRKBG; RAC-PK-gamma; RAC-gamma; STK-2
Designation : PKB gamma|RAC-gamma serine/threonine protein kinase|RAC-gamma serine/threonine-protein kinase|v-akt murine thymoma viral oncogene homolog 3 (protein kinase B, gamma)
Full Nomenclature : v-akt murine thymoma viral oncogene homolog 3
GENEID : 10000
GI : 33304020
GenBank Accession : AY335691
HGNC : 393
MIM : 611223
Vega : OTTHUMG00000039994
Target GenBank: NM_005465

 

Reference Sequence Alignment

  

HsCD00001396        ATGAGCGATGTTACCATTGTGAAAGAAGGTTGGGTTCAGAAGAGGGGAGAATATATAAAA
NM_005465.4         ATGAGCGATGTTACCATTGTGAAAGAAGGTTGGGTTCAGAAGAGGGGAGAATATATAAAA
NM_181690.2         ATGAGCGATGTTACCATTGTGAAAGAAGGTTGGGTTCAGAAGAGGGGAGAATATATAAAA
NM_001206729.1      ATGAGCGATGTTACCATTGTGAAAGAAGGTTGGGTTCAGAAGAGGGGAGAATATATAAAA
                    ************************************************************

HsCD00001396        AACTGGAGGCCAAGATACTTCCTTTTGAAGACAGATGGCTCATTCATAGGATATAAAGAG
NM_005465.4         AACTGGAGGCCAAGATACTTCCTTTTGAAGACAGATGGCTCATTCATAGGATATAAAGAG
NM_181690.2         AACTGGAGGCCAAGATACTTCCTTTTGAAGACAGATGGCTCATTCATAGGATATAAAGAG
NM_001206729.1      AACTGGAGGCCAAGATACTTCCTTTTGAAGACAGATGGCTCATTCATAGGATATAAAGAG
                    ************************************************************

HsCD00001396        AAACCTCAAGATGTGGATTTACCTTATCCCCTCAACAACTTTTCAGTGGCAAAATGCCAG
NM_005465.4         AAACCTCAAGATGTGGATTTACCTTATCCCCTCAACAACTTTTCAGTGGCAAAATGCCAG
NM_181690.2         AAACCTCAAGATGTGGATTTACCTTATCCCCTCAACAACTTTTCAGTGGCAAAATGCCAG
NM_001206729.1      AAACCTCAAGATGTGGATTTACCTTATCCCCTCAACAACTTTTCAGTGGCAAAATGCCAG
                    ************************************************************

HsCD00001396        TTAATGAAAACAGAACGACCAAAGCCAAACACATTTATAATCAGATGTCTCCAGTGGACT
NM_005465.4         TTAATGAAAACAGAACGACCAAAGCCAAACACATTTATAATCAGATGTCTCCAGTGGACT
NM_181690.2         TTAATGAAAACAGAACGACCAAAGCCAAACACATTTATAATCAGATGTCTCCAGTGGACT
NM_001206729.1      TTAATGAAAACAGAACGACCAAAGCCAAACACATTTATAATCAGATGTCTCCAGTGGACT
                    ************************************************************

HsCD00001396        ACTGTTATAGAGAGAACATTTCATGTAGATACTCCAGAGGAAAGGGAAGAATGGACAGAA
NM_005465.4         ACTGTTATAGAGAGAACATTTCATGTAGATACTCCAGAGGAAAGGGAAGAATGGACAGAA
NM_181690.2         ACTGTTATAGAGAGAACATTTCATGTAGATACTCCAGAGGAAAGGGAAGAATGGACAGAA
NM_001206729.1      ACTGTTATAGAGAGAACATTTCATGTAGATACTCCAGAGGAAAGGGAAGAATGGACAGAA
                    ************************************************************

HsCD00001396        GCTATCCAGGCTGTAGCAGACAGACTGCAGAGGCAAGAAGAGGAGAGAATGAATTGTAGT
NM_005465.4         GCTATCCAGGCTGTAGCAGACAGACTGCAGAGGCAAGAAGAGGAGAGAATGAATTGTAGT
NM_181690.2         GCTATCCAGGCTGTAGCAGACAGACTGCAGAGGCAAGAAGAGGAGAGAATGAATTGTAGT
NM_001206729.1      GCTATCCAGGCTGTAGCAGACAGACTGCAGAGGCAAGAAGAGGAGAGAATGAATTGTAGT
                    ************************************************************

HsCD00001396        CCAACTTCACAAATTGATAATATAGGAGAGGAAGAGATGGATGCCTCTACAACCCATCAT
NM_005465.4         CCAACTTCACAAATTGATAATATAGGAGAGGAAGAGATGGATGCCTCTACAACCCATCAT
NM_181690.2         CCAACTTCACAAATTGATAATATAGGAGAGGAAGAGATGGATGCCTCTACAACCCATCAT
NM_001206729.1      CCAACTTCACAAATTGATAATATAGGAGAGGAAGAGATGGATGCCTCTACAACCCATCAT
                    ************************************************************

HsCD00001396        AAAAGAAAGACAATGAATGATTTTGACTATTTGAAACTACTAGGTAAAGGCACTTTTGGG
NM_005465.4         AAAAGAAAGACAATGAATGATTTTGACTATTTGAAACTACTAGGTAAAGGCACTTTTGGG
NM_181690.2         AAAAGAAAGACAATGAATGATTTTGACTATTTGAAACTACTAGGTAAAGGCACTTTTGGG
NM_001206729.1      AAAAGAAAGACAATGAATGATTTTGACTATTTGAAACTACTAGGTAAAGGCACTTTTGGG
                    ************************************************************

HsCD00001396        AAAGTTATTTTGGTTCGAGAGAAGGCAAGTGGAAAATACTATGCTATGAAGATTCTGAAG
NM_005465.4         AAAGTTATTTTGGTTCGAGAGAAGGCAAGTGGAAAATACTATGCTATGAAGATTCTGAAG
NM_181690.2         AAAGTTATTTTGGTTCGAGAGAAGGCAAGTGGAAAATACTATGCTATGAAGATTCTGAAG
NM_001206729.1      AAAGTTATTTTGGTTCGAGAGAAGGCAAGTGGAAAATACTATGCTATGAAGATTCTGAAG
                    ************************************************************

HsCD00001396        AAAGAAGTCATTATTGCAAAGGATGAAGTGGCACACACTCTAACTGAAAGCAGAGTATTA
NM_005465.4         AAAGAAGTCATTATTGCAAAGGATGAAGTGGCACACACTCTAACTGAAAGCAGAGTATTA
NM_181690.2         AAAGAAGTCATTATTGCAAAGGATGAAGTGGCACACACTCTAACTGAAAGCAGAGTATTA
NM_001206729.1      AAAGAAGTCATTATTGCAAAGGATGAAGTGGCACACACTCTAACTGAAAGCAGAGTATTA
                    ************************************************************

HsCD00001396        AAGAACACTAGACATCCCTTTTTAACATCCTTGAAATATTCCTTCCAGACAAAAGACCGT
NM_005465.4         AAGAACACTAGACATCCCTTTTTAACATCCTTGAAATATTCCTTCCAGACAAAAGACCGT
NM_181690.2         AAGAACACTAGACATCCCTTTTTAACATCCTTGAAATATTCCTTCCAGACAAAAGACCGT
NM_001206729.1      AAGAACACTAGACATCCCTTTTTAACATCCTTGAAATATTCCTTCCAGACAAAAGACCGT
                    ************************************************************

HsCD00001396        TTGTGTTTTGTGATGGAATATGTTAATGGGGGCGAGCTGTTTTTCCATTTGTCGAGAGAG
NM_005465.4         TTGTGTTTTGTGATGGAATATGTTAATGGGGGCGAGCTGTTTTTCCATTTGTCGAGAGAG
NM_181690.2         TTGTGTTTTGTGATGGAATATGTTAATGGGGGCGAGCTGTTTTTCCATTTGTCGAGAGAG
NM_001206729.1      TTGTGTTTTGTGATGGAATATGTTAATGGGGGCGAGCTGTTTTTCCATTTGTCGAGAGAG
                    ************************************************************

HsCD00001396        CGGGTGTTCTCTGAGGACCGCACACGTTTCTATGGTGCAGAAATTGTCTCTGCCTTGGAC
NM_005465.4         CGGGTGTTCTCTGAGGACCGCACACGTTTCTATGGTGCAGAAATTGTCTCTGCCTTGGAC
NM_181690.2         CGGGTGTTCTCTGAGGACCGCACACGTTTCTATGGTGCAGAAATTGTCTCTGCCTTGGAC
NM_001206729.1      CGGGTGTTCTCTGAGGACCGCACACGTTTCTATGGTGCAGAAATTGTCTCTGCCTTGGAC
                    ************************************************************

HsCD00001396        TATCTACATTCCGGAAAGATTGTGTACCGTGATCTCAAGTTGGAGAATCTAATGCTGGAC
NM_005465.4         TATCTACATTCCGGAAAGATTGTGTACCGTGATCTCAAGTTGGAGAATCTAATGCTGGAC
NM_181690.2         TATCTACATTCCGGAAAGATTGTGTACCGTGATCTCAAGTTGGAGAATCTAATGCTGGAC
NM_001206729.1      TATCTACATTCCGGAAAGATTGTGTACCGTGATCTCAAGTTGGAGAATCTAATGCTGGAC
                    ************************************************************

HsCD00001396        AAAGATGGCCACATAAAAATTACAGATTTTGGACTTTGCAAAGAAGGGATCACAGATGCA
NM_005465.4         AAAGATGGCCACATAAAAATTACAGATTTTGGACTTTGCAAAGAAGGGATCACAGATGCA
NM_181690.2         AAAGATGGCCACATAAAAATTACAGATTTTGGACTTTGCAAAGAAGGGATCACAGATGCA
NM_001206729.1      AAAGATGGCCACATAAAAATTACAGATTTTGGACTTTGCAAAGAAGGGATCACAGATGCA
                    ************************************************************

HsCD00001396        GCCACCATGAAGACATTCTGTGGCACTCCAGAATATCTGGCACCAGAGGTGTTAGAAGAT
NM_005465.4         GCCACCATGAAGACATTCTGTGGCACTCCAGAATATCTGGCACCAGAGGTGTTAGAAGAT
NM_181690.2         GCCACCATGAAGACATTCTGTGGCACTCCAGAATATCTGGCACCAGAGGTGTTAGAAGAT
NM_001206729.1      GCCACCATGAAGACATTCTGTGGCACTCCAGAATATCTGGCACCAGAGGTGTTAGAAGAT
                    ************************************************************

HsCD00001396        AATGACTATGGCCGAGCAGTAGACTGGTGGGGCCTAGGGGTTGTCATGTATGAAATGATG
NM_005465.4         AATGACTATGGCCGAGCAGTAGACTGGTGGGGCCTAGGGGTTGTCATGTATGAAATGATG
NM_181690.2         AATGACTATGGCCGAGCAGTAGACTGGTGGGGCCTAGGGGTTGTCATGTATGAAATGATG
NM_001206729.1      AATGACTATGGCCGAGCAGTAGACTGGTGGGGCCTAGGGGTTGTCATGTATGAAATGATG
                    ************************************************************

HsCD00001396        TGTGGGAGGTTACCTTTCTACAACCAGGACCATGAGAAACTTTTTGAATTAATATTAATG
NM_005465.4         TGTGGGAGGTTACCTTTCTACAACCAGGACCATGAGAAACTTTTTGAATTAATATTAATG
NM_181690.2         TGTGGGAGGTTACCTTTCTACAACCAGGACCATGAGAAACTTTTTGAATTAATATTAATG
NM_001206729.1      TGTGGGAGGTTACCTTTCTACAACCAGGACCATGAGAAACTTTTTGAATTAATATTAATG
                    ************************************************************

HsCD00001396        GAAGACATTAAATTTCCTCGAACACTCTCTTCAGATGCAAAATCATTGCTTTCAGGGCTC
NM_005465.4         GAAGACATTAAATTTCCTCGAACACTCTCTTCAGATGCAAAATCATTGCTTTCAGGGCTC
NM_181690.2         GAAGACATTAAATTTCCTCGAACACTCTCTTCAGATGCAAAATCATTGCTTTCAGGGCTC
NM_001206729.1      GAAGACATTAAATTTCCTCGAACACTCTCTTCAGATGCAAAATCATTGCTTTCAGGGCTC
                    ************************************************************

HsCD00001396        TTGATAAAGGATCCAAATAAACGCCTTGGTGGAGGACCAGATGATGCAAAAGAAATTATG
NM_005465.4         TTGATAAAGGATCCAAATAAACGCCTTGGTGGAGGACCAGATGATGCAAAAGAAATTATG
NM_181690.2         TTGATAAAGGATCCAAATAAACGCCTTGGTGGAGGACCAGATGATGCAAAAGAAATTATG
NM_001206729.1      TTGATAAAGGATCCAAATAAACGCCTTGGTGGAGGACCAGATGATGCAAAAGAAATTATG
                    ************************************************************

HsCD00001396        AGACACAGTTTCTTCTCTGGAGTAAACTGGCAAGATGTATATGATAAAAAGCTTGTACCT
NM_005465.4         AGACACAGTTTCTTCTCTGGAGTAAACTGGCAAGATGTATATGATAAAAAGCTTGTACCT
NM_181690.2         AGACACAGTTTCTTCTCTGGAGTAAACTGGCAAGATGTATATGATAAAAAGCTTGTACCT
NM_001206729.1      AGACACAGTTTCTTCTCTGGAGTAAACTGGCAAGATGTATATGATAAAAAGCTTGTACCT
                    ************************************************************

HsCD00001396        CCTTTTAAACCTCAAGTAACATCTGAGACAGATACTAGATATTTTGATGAAGAATTTACA
NM_005465.4         CCTTTTAAACCTCAAGTAACATCTGAGACAGATACTAGATATTTTGATGAAGAATTTACA
NM_181690.2         CCTTTTAAACCTCAAGTAACATCTGAGACAGATACTAGATATTTTGATGAAGAATTTACA
NM_001206729.1      CCTTTTAAACCTCAAGTAACATCTGAGACAGATACTAGATATTTTGATGAAGAATTTACA
                    ************************************************************

HsCD00001396        GCTCAGACTATTACAATAACACCACCTGAAAAATATGATGAGGATGGTATGGACTGCATG
NM_005465.4         GCTCAGACTATTACAATAACACCACCTGAAAAATATGATGAGGATGGTATGGACTGCATG
NM_181690.2         GCTCAGACTATTACAATAACACCACCTGAAAAATGTCAGCAATCAGATTGTGGCATGCTG
NM_001206729.1      GCTCAGACTATTACAATAACACCACCTGAAAAATGTCAGCAATCAGATTGTGGCATGCTG
                    **********************************.* *  *. .:*.*:  *.*:  .**

HsCD00001396        GACAATGAGAGGCGGCCGCATTTCCCTCAATTTTCCTACTCTGCAAGTGGACGAGAATTG
NM_005465.4         GACAATGAGAGGCGGCCGCATTTCCCTCAATTTTCCTACTCTGCAAGTGGACGAGAATAA
NM_181690.2         GGTAACTGGAAAAAATAA------------------------------------------
NM_001206729.1      GGTAACTGGAAAAAATAA------------------------------------------
                    *. **  .**..... ..                                          

Pathways

NCI : Class I PI3K signaling events mediated by Akt
NCI : S1P3 pathway
Panther : Angiogenesis
Panther : Apoptosis signaling pathway
Panther : EGF receptor signaling pathway
Panther : Endothelin signaling pathway
Panther : FGF signaling pathway
Panther : Huntington disease
Panther : Hypoxia response via HIF activation
Panther : Inflammation mediated by chemokine and cytokine signaling pathway
Panther : Interleukin signaling pathway
Panther : PI3 kinase pathway
Panther : Ras Pathway
Panther : T cell activation
Panther : p53 pathway
Panther : p53 pathway by glucose deprivation
Panther : p53 pathway feedback loops 2
Reactome : AKT phosphorylates targets in the cytosol
Reactome : AKT phosphorylates targets in the nucleus
Reactome : AKT-mediated inactivation of FOXO1A
Reactome : Activation of BAD and translocation to mitochondria
Reactome : Activation of BH3-only proteins
Reactome : Adaptive Immune System
Reactome : Apoptosis
Reactome : CD28 co-stimulation
Reactome : CD28 dependent PI3K/Akt signaling
Reactome : CTLA4 inhibitory signaling
Reactome : Constitutive PI3K/AKT Signaling in Cancer
Reactome : Costimulation by the CD28 family
Reactome : DAP12 interactions
Reactome : DAP12 signaling
Reactome : Developmental Biology
Reactome : Disease
Reactome : Downregulation of ERBB2:ERBB3 signaling
Reactome : Downstream signal transduction
Reactome : Downstream signaling events of B Cell Receptor (BCR)
Reactome : Downstream signaling of activated FGFR
Reactome : Fc epsilon receptor (FCERI) signaling
Reactome : G beta:gamma signalling through PI3Kgamma
Reactome : G-protein beta:gamma signalling
Reactome : GAB1 signalosome
Reactome : GPCR downstream signaling
Reactome : GPVI-mediated activation cascade
Reactome : Hemostasis
Reactome : Immune System
Reactome : Innate Immune System
Reactome : Intrinsic Pathway for Apoptosis
Reactome : NGF signalling via TRKA from the plasma membrane
Reactome : Negative regulation of the PI3K/AKT network
Reactome : PI-3K cascade
Reactome : PI3K events in ERBB2 signaling
Reactome : PI3K events in ERBB4 signaling
Reactome : PI3K/AKT Signaling in Cancer
Reactome : PI3K/AKT activation
Reactome : PIP3 activates AKT signaling
Reactome : Platelet activation, signaling and aggregation
Reactome : Regulation of beta-cell development
Reactome : Regulation of gene expression in beta cells
Reactome : Role of LAT2/NTAL/LAB on calcium mobilization
Reactome : Signal Transduction
Reactome : Signaling by EGFR
Reactome : Signaling by EGFR in Cancer
Reactome : Signaling by ERBB2
Reactome : Signaling by ERBB4
Reactome : Signaling by FGFR
Reactome : Signaling by FGFR in disease
Reactome : Signaling by GPCR
Reactome : Signaling by PDGF
Reactome : Signaling by SCF-KIT
Reactome : Signaling by the B Cell Receptor (BCR)
Reactome : Signalling by NGF
WikiPathway : ErbB signaling pathway
WikiPathway : Focal Adhesion
WikiPathway : Integrin-mediated cell adhesion
WikiPathway : MAPK signaling pathway
WikiPathway : Regulation of toll-like receptor signaling pathway
WikiPathway : Signal Transduction of S1P Receptor
WikiPathway : Toll-like receptor signaling pathway

Clone

Cloning Information : 146
HIP Master Clone ID : 87204
Original Clone ID : FLH000146.01L

Organism


TAX_ID : 9606
Species Specific ID: 10000

Genome

Chromosome : 1
Map Location : 1q44
Ensembl : ENSG00000117020

Reagents

Labome : AKT3-antibody