DNASU Plasmid Repository • 480.965.5697 | Email

CDKN1A (Homo sapiens) in pDONR201 (Gateway donor/master vector)

TOP

Explanation of Terms


Gene: Gene Symbol:  CDKN1A
Gene Name:  cyclin-dependent kinase inhibitor 1A (p21, Cip1)
Sequence              Map: pDONR cofig.pdf
Original Clone ID: FLH054333.01L
Keyword: None
Species: Homo sapiens
Type: cDNA
Vector Name: pDONR201               Format:  FUSION
Source: HIP
Description: None
Comments: None
Mutation/
Discrepancy :
No / No
Publications: None
Authors: HIP
HsCD00001447

Price:  Login for Pricing
AVAILABLE
No restriction
Special MTA: None

 

Insert sequence: 495nts         Open reading frame : 1 to 495
Reference Sequence Alignment

ATGTCAGAACCGGCTGGGGATGTCCGTCAGAACCCATGCGGCAGCAAGGCCTGCCGCCGC
CTCTTCGGCCCAGTGGACAGCGAGCAGCTGAGCCGCGACTGTGATGCGCTAATGGCGGGC
TGCATCCAGGAGGCCCGTGAGCGATGGAACTTCGACTTTGTCACCGAGACACCACTGGAG
GGTGACTTCGCCTGGGAGCGTGTGCGGGGCCTTGGCCTGCCCAAGCTCTACCTTCCCACG
GGGCCCCGGCGAGGCCGGGATGAGTTGGGAGGAGGCAGGCGGCCTGGCACCTCACCTGCT
CTGCTGCAGGGGACAGCAGAGGAAGACCATGTGGACCTGTCACTGTCTTGTACCCTTGTG
CCTCGCTCAGGGGAGCAGGCTGAAGGGTCCCCAGGTGGACCTGGAGACTCTCAGGGTCGA
AAACGGCGGCAGACCAGCATGACAGATTTCTACCACTCCAAACGCCGGCTGATCTTCTCC
AAGAGGAAGCCCTTG


Coding Sequence Details
Insert Sequence Verified?: Y Verification Method: Sequence Verification
Reference Sequence Annotations:
End on reference sequence 570
Start on reference sequence 76
Mutations:
None
Discrepancy:
None
5' Linker Sequence:
GTACAAAAAAGCAGGCTCCACC(atg-goi)

3' Linker Sequence:
(goi-stop)GACCCAGCTTTCTTGTAC

 

 Recommended Growth Condition:

Distributed in bacterial strain : DH5-alpha T1 phage resistant
Antibiotic Selection: Host Type:  bacterial    Marker:  kanamycin
Bacterial Selection Condition:  50ug/mL kanamycin
Growth Condition:  Growth with the single antibiotic in LB at 37 degrees is recommended.
Comments:  Conditions for Gateway-type vectors in recombined (with insert) form and other kanamycin resistant vectors.
Protein Expression Results: None
Recommended expression in: Not Applicable
       DyNA Vector Map

         Powered by LabGenius

Vector Name: pDONR201

pDONR201 in advanced viewed

Synonyms: None
Sequencing Primer: Forward:  pDONR201-forward
Reverse:  pDONR201-reverse
Description: Recombinational donor/master vector; kanamycin resistance; recombinational cloning.
Comments: The position of features were determined for the unrecombined (empty) form of the vector, which is described in detail on the Invitrogen website.
Size (bp): 4470
Parent Vector: None
Empty Vector: None
Properties: Gateway, donor (entry), recombinational cloning
Author Name: Invitrogen
Publications: None
Vector Map:         Vector Sequence:
Sequence:

 



Vector Features:

Type Name Description Start Position End Position
bacterial origin ColE ColE1 (pUC-type) origin of replication (modified, low copy number) 3744 4426
negative selection marker ccdB ccdB negative selection gene (death cassette), LOST in recombined (with insert) form 1264 959
primer site forward primer recommended forward primer site 5 tcgcgttaacgctagcatggatctc 3 300 324
primer site reverse primer recommended reverse primer site 5 gtaacatcagagattttgagacac 3 2769 2792
recombination site attL2 attL recombination site 2 present in recombined (with insert) form only, position is approximate 2744 2513
recombination site attP1 attP recombination site 1 LOST in recombined (with insert) form 332 563
recombination site attP2 attP recombination site 2 LOST in recombined (with insert) form 2744 2513
recombination site attL1 attL recombination site 1 present in recombined (with insert) form only, position is approximate 332 563
selectable marker CmR chloramphenicol resistance gene, LOST in recombined (with insert) form 2265 2513
selectable marker KanR kanamycin resistance gene 2868 3677
trxn termination sequence rrn T2 rrn T2 transcription termination sequence 73 100
trxn termination sequence rrn T1 rrn T1 transcription termination sequence 232 275

 

  • Gene
  • Pathways
  • Protein
  • Clone
  • Organism
  • Genome
  • Reagents

Gene

 

Gene Symbol : CDKN1A
Symbol Nomenclature : CDKN1A
SYNONYM : CAP20; CDKN1; CIP1; MDA-6; P21; SDI1; WAF1; p21CIP1
Designation : CDK-interacting protein 1|CDK-interaction protein 1|DNA synthesis inhibitor|cyclin-dependent kinase inhibitor 1|melanoma differentiation associated protein 6|wild-type p53-activated fragment 1
Full Nomenclature : cyclin-dependent kinase inhibitor 1A (p21, Cip1)
GENEID : 1026
GI : 60829107
GenBank Accession : AY893828
HGNC : 1784
MIM : 116899
Vega : OTTHUMG00000014603
Target GenBank: NM_000389

 

Reference Sequence Alignment

  

HsCD00001447        ATGTCAGAACCGGCTGGGGATGTCCGTCAGAACCCATGCGGCAGCAAGGCCTGCCGCCGC
NM_001220777.1      ATGTCAGAACCGGCTGGGGATGTCCGTCAGAACCCATGCGGCAGCAAGGCCTGCCGCCGC
NM_078467.2         ATGTCAGAACCGGCTGGGGATGTCCGTCAGAACCCATGCGGCAGCAAGGCCTGCCGCCGC
NM_000389.4         ATGTCAGAACCGGCTGGGGATGTCCGTCAGAACCCATGCGGCAGCAAGGCCTGCCGCCGC
NM_001220778.1      ATGTCAGAACCGGCTGGGGATGTCCGTCAGAACCCATGCGGCAGCAAGGCCTGCCGCCGC
                    ************************************************************

HsCD00001447        CTCTTCGGCCCAGTGGACAGCGAGCAGCTGAGCCGCGACTGTGATGCGCTAATGGCGGGC
NM_001220777.1      CTCTTCGGCCCAGTGGACAGCGAGCAGCTGAGCCGCGACTGTGATGCGCTAATGGCGGGC
NM_078467.2         CTCTTCGGCCCAGTGGACAGCGAGCAGCTGAGCCGCGACTGTGATGCGCTAATGGCGGGC
NM_000389.4         CTCTTCGGCCCAGTGGACAGCGAGCAGCTGAGCCGCGACTGTGATGCGCTAATGGCGGGC
NM_001220778.1      CTCTTCGGCCCAGTGGACAGCGAGCAGCTGAGCCGCGACTGTGATGCGCTAATGGCGGGC
                    ************************************************************

HsCD00001447        TGCATCCAGGAGGCCCGTGAGCGATGGAACTTCGACTTTGTCACCGAGACACCACTGGAG
NM_001220777.1      TGCATCCAGGAGGCCCGTGAGCGATGGAACTTCGACTTTGTCACCGAGACACCACTGGAG
NM_078467.2         TGCATCCAGGAGGCCCGTGAGCGATGGAACTTCGACTTTGTCACCGAGACACCACTGGAG
NM_000389.4         TGCATCCAGGAGGCCCGTGAGCGATGGAACTTCGACTTTGTCACCGAGACACCACTGGAG
NM_001220778.1      TGCATCCAGGAGGCCCGTGAGCGATGGAACTTCGACTTTGTCACCGAGACACCACTGGAG
                    ************************************************************

HsCD00001447        GGTGACTTCGCCTGGGAGCGTGTGCGGGGCCTTGGCCTGCCCAAGCTCTACCTTCCCACG
NM_001220777.1      GGTGACTTCGCCTGGGAGCGTGTGCGGGGCCTTGGCCTGCCCAAGCTCTACCTTCCCACG
NM_078467.2         GGTGACTTCGCCTGGGAGCGTGTGCGGGGCCTTGGCCTGCCCAAGCTCTACCTTCCCACG
NM_000389.4         GGTGACTTCGCCTGGGAGCGTGTGCGGGGCCTTGGCCTGCCCAAGCTCTACCTTCCCACG
NM_001220778.1      GGTGACTTCGCCTGGGAGCGTGTGCGGGGCCTTGGCCTGCCCAAGCTCTACCTTCCCACG
                    ************************************************************

HsCD00001447        GGGCCCCGGCGAGGCCGGGATGAGTTGGGAGGAGGCAGGCGGCCTGGCACCTCACCTGCT
NM_001220777.1      GGGCCCCGGCGAGGCCGGGATGAGTTGGGAGGAGGCAGGCGGCCTGGCACCTCACCTGCT
NM_078467.2         GGGCCCCGGCGAGGCCGGGATGAGTTGGGAGGAGGCAGGCGGCCTGGCACCTCACCTGCT
NM_000389.4         GGGCCCCGGCGAGGCCGGGATGAGTTGGGAGGAGGCAGGCGGCCTGGCACCTCACCTGCT
NM_001220778.1      GGGCCCCGGCGAGGCCGGGATGAGTTGGGAGGAGGCAGGCGGCCTGGCACCTCACCTGCT
                    ************************************************************

HsCD00001447        CTGCTGCAGGGGACAGCAGAGGAAGACCATGTGGACCTGTCACTGTCTTGTACCCTTGTG
NM_001220777.1      CTGCTGCAGGGGACAGCAGAGGAAGACCATGTGGACCTGTCACTGTCTTGTACCCTTGTG
NM_078467.2         CTGCTGCAGGGGACAGCAGAGGAAGACCATGTGGACCTGTCACTGTCTTGTACCCTTGTG
NM_000389.4         CTGCTGCAGGGGACAGCAGAGGAAGACCATGTGGACCTGTCACTGTCTTGTACCCTTGTG
NM_001220778.1      CTGCTGCAGGGGACAGCAGAGGAAGACCATGTGGACCTGTCACTGTCTTGTACCCTTGTG
                    ************************************************************

HsCD00001447        CCTCGCTCAGGGGAGCAGGCTGAAGGGTCCCCAGGTGGACCTGGAGACTCTCAGGGTCGA
NM_001220777.1      CCTCGCTCAGGGGAGCAGGCTGAAGGGTCCCCAGGTGGACCTGGAGACTCTCAGGGTCGA
NM_078467.2         CCTCGCTCAGGGGAGCAGGCTGAAGGGTCCCCAGGTGGACCTGGAGACTCTCAGGGTCGA
NM_000389.4         CCTCGCTCAGGGGAGCAGGCTGAAGGGTCCCCAGGTGGACCTGGAGACTCTCAGGGTCGA
NM_001220778.1      CCTCGCTCAGGGGAGCAGGCTGAAGGGTCCCCAGGTGGACCTGGAGACTCTCAGGGTCGA
                    ************************************************************

HsCD00001447        AAACGGCGGCAGACCAGCATGACAGATTTCTACCACTCCAAACGCCGGCTGATCTTCTCC
NM_001220777.1      AAACGGCGGCAGACCAGCATGACAGATTTCTACCACTCCAAACGCCGGCTGATCTTCTCC
NM_078467.2         AAACGGCGGCAGACCAGCATGACAGATTTCTACCACTCCAAACGCCGGCTGATCTTCTCC
NM_000389.4         AAACGGCGGCAGACCAGCATGACAGATTTCTACCACTCCAAACGCCGGCTGATCTTCTCC
NM_001220778.1      AAACGGCGGCAGACCAGCATGACAGATTTCTACCACTCCAAACGCCGGCTGATCTTCTCC
                    ************************************************************

HsCD00001447        AAGAGGAAGCCCTTG
NM_001220777.1      AAGAGGAAGCCCTAA
NM_078467.2         AAGAGGAAGCCCTAA
NM_000389.4         AAGAGGAAGCCCTAA
NM_001220778.1      AAGAGGAAGCCCTAA
                    *************:.

Pathways

NCI : Angiopoietin receptor Tie2-mediated signaling
NCI : C-MYB transcription factor network
NCI : Class I PI3K signaling events mediated by Akt
NCI : Direct p53 effectors
NCI : E2F transcription factor network
NCI : Glucocorticoid receptor regulatory network
NCI : Notch signaling pathway
NCI : Regulation of nuclear SMAD2/3 signaling
NCI : Regulation of retinoblastoma protein
NCI : Signaling events mediated by HDAC Class III
NCI : Signaling events mediated by PRL
NCI : Validated targets of C-MYC transcriptional repression
NCI : Validated transcriptional targets of TAp63 isoforms
NCI : p73 transcription factor network
Panther : Interleukin signaling pathway
Panther : p53 pathway
Panther : p53 pathway feedback loops 2
Reactome : AKT phosphorylates targets in the cytosol
Reactome : Adaptive Immune System
Reactome : Cell Cycle
Reactome : Cell Cycle Checkpoints
Reactome : Cell Cycle, Mitotic
Reactome : Cellular Senescence
Reactome : Cellular responses to stress
Reactome : Constitutive PI3K/AKT Signaling in Cancer
Reactome : Cyclin A:Cdk2-associated events at S phase entry
Reactome : Cyclin D associated events in G1
Reactome : Cyclin E associated events during G1/S transition
Reactome : DAP12 interactions
Reactome : DAP12 signaling
Reactome : DNA Damage/Telomere Stress Induced Senescence
Reactome : DNA Replication
Reactome : Disease
Reactome : Downstream signal transduction
Reactome : Downstream signaling events of B Cell Receptor (BCR)
Reactome : Downstream signaling of activated FGFR
Reactome : Fc epsilon receptor (FCERI) signaling
Reactome : Formation of Senescence-Associated Heterochromatin Foci (SAHF)
Reactome : G1 Phase
Reactome : G1/S DNA Damage Checkpoints
Reactome : G1/S Transition
Reactome : GAB1 signalosome
Reactome : Immune System
Reactome : Innate Immune System
Reactome : Mitotic G1-G1/S phases
Reactome : NGF signalling via TRKA from the plasma membrane
Reactome : Orc1 removal from chromatin
Reactome : PI-3K cascade
Reactome : PI3K events in ERBB2 signaling
Reactome : PI3K events in ERBB4 signaling
Reactome : PI3K/AKT Signaling in Cancer
Reactome : PI3K/AKT activation
Reactome : PIP3 activates AKT signaling
Reactome : Regulation of DNA replication
Reactome : Removal of licensing factors from origins
Reactome : Role of LAT2/NTAL/LAB on calcium mobilization
Reactome : S Phase
Reactome : SCF(Skp2)-mediated degradation of p27/p21
Reactome : Senescence-Associated Secretory Phenotype (SASP)
Reactome : Signal Transduction
Reactome : Signaling by EGFR
Reactome : Signaling by EGFR in Cancer
Reactome : Signaling by ERBB2
Reactome : Signaling by ERBB4
Reactome : Signaling by FGFR
Reactome : Signaling by FGFR in disease
Reactome : Signaling by PDGF
Reactome : Signaling by SCF-KIT
Reactome : Signaling by the B Cell Receptor (BCR)
Reactome : Signalling by NGF
Reactome : Switching of origins to a post-replicative state
Reactome : Synthesis of DNA
Reactome : Transcriptional activation of cell cycle inhibitor p21
Reactome : Transcriptional activation of p53 responsive genes
Reactome : p53-Dependent G1 DNA Damage Response
Reactome : p53-Dependent G1/S DNA damage checkpoint
WikiPathway : AMPK signaling
WikiPathway : Adipogenesis
WikiPathway : Androgen receptor signaling pathway
WikiPathway : Cell cycle
WikiPathway : DNA damage response
WikiPathway : DNA damage response (only ATM dependent)
WikiPathway : ErbB signaling pathway
WikiPathway : G1 to S cell cycle control
WikiPathway : Lymphocyte TarBase
WikiPathway : Muscle cell TarBase
WikiPathway : Notch Signaling Pathway
WikiPathway : Senescence and Autophagy
WikiPathway : TP53 network
WikiPathway : miRNA regulation of DNA Damage Response
WikiPathway : miRNAs involved in DDR

Protein

UniProt : P38936
UniProt : Q6FI05
HPRD : 00298

Clone

Cloning Information : 54333
HIP Master Clone ID : 10594
Original Clone ID : FLH054333.01L

Organism


TAX_ID : 9606
Species Specific ID: 1026

Genome

Chromosome : 6
Map Location : 6p21.2
Ensembl : ENSG00000124762

Reagents

Labome : p21-antibody