DNASU Plasmid Repository • 480.965.5697 | Email

CDK4 (Homo sapiens) in pDONR201 (Gateway donor/master vector)

TOP

Explanation of Terms


Gene: Gene Symbol:  CDK4
Gene Name:  cyclin-dependent kinase 4
Sequence              Map: pDONR cofig.pdf
Original Clone ID: FLH056457.01L
Keyword: None
Species: Homo sapiens
Type: cDNA
Vector Name: pDONR201               Format:  FUSION
Source: HIP
Description: None
Comments: None
Mutation/
Discrepancy :
No / Yes
Publications: PMID: 15928075
Title: Building a human kinase gene repository: bioinformatics, molecular cloning, and functional validation.
Authors: HIP
HsCD00001470

Price:  Login for Pricing
AVAILABLE
No restriction
Special MTA: None

 

Insert sequence: 912nts         Open reading frame : 1 to 912
Reference Sequence Alignment

ATGGCTACCTCTCGATATGAGCCAGTGGCTGAAATTGGTGTCGGTGCCTATGGGACAGTG
TACAAGGCCCGTGATCCCCACAGTGGCCACTTTGTGGCCCTCAAGAGTGTGAGAGTCCCC
AATGGAGGAGGAGGTGGAGGAGGCCTTCCCATCAGCACAGTTCGTGAGGTGGCTTTACTG
AGGCGACTGGAGGCTTTTGAGCATCCCAATGTTGTCCGGCTGATGGACGTCTGTGCCACA
TCCCGAACTGACCGGGAGATCAGGGTAACCCTGGTGTTTGAGCATGTAGACCAGGACCTA
AGGACATATCTGGACAAGGCACCCCCACCAGGCTTGCCAGCCGAAACGATCAAGGATCTG
ATGCGCCAGTTTCTAAGAGGCCTAGATTTCCTTCATGCCAATTGCATCGTTCACCGAGAT
CTGAAGCCAGAGAACATTCTGGTGACAAGTGGTGGAACAGTCAAGCTGGCTGACTTTGGC
CTGGCCAGAATCTACAGCTACCAGATGGCACTTACACCCGTGGTTGTTACACTCTGGTAC
CGAGCTCCCGAAGTTCTTCTGCAGTCCACATATGCAACACCTGTGGACATGTGGAGTGTT
GGCTGTATCTTTGCAGAGATGTTTCGTCGAAAGCCTCTCTTCTGTGGAAACTCTGAAGCC
GACCAGTTGGGCAAAATCTTTGACCTGATTGGGCTGCCTCCAGAGGATGACTGGCCTCGA
GATGTATCCCTGCCCCGTGGAGCCTTTCCCCCCAGAGGGCCCCGCCCAGTGCAGTCGGTG
GTACCTGAGATGGAGGAGTCGGGAGCACAGCTGCTGCTGGAAATGCTGACTTTTAACCCA
CACAAGCGAATCTCTGCCTTTCGAGCTCTGCAGCACTCTTATCTACATAAGGATGAAGGT
AATCCGGAGTTG


Coding Sequence Details
Insert Sequence Verified?: Y Verification Method: Sequence Verification
Reference Sequence Annotations:
End on reference sequence 1138
Start on reference sequence 227
Mutations:
None
Discrepancy:
a263g,K88R
                                

5' Linker Sequence:
GTACAAAAAAGCAGGCTCCACC(atg-goi)

3' Linker Sequence:
(goi-stop)GACCCAGCTTTCTTGTAC

 

 Recommended Growth Condition:

Distributed in bacterial strain : DH5-alpha T1 phage resistant
Antibiotic Selection: Host Type:  bacterial    Marker:  kanamycin
Bacterial Selection Condition:  50ug/mL kanamycin
Growth Condition:  Growth with the single antibiotic in LB at 37 degrees is recommended.
Comments:  Conditions for Gateway-type vectors in recombined (with insert) form and other kanamycin resistant vectors.
Protein Expression Results: None
Recommended expression in: Not Applicable
       DyNA Vector Map

         Powered by LabGenius

Vector Name: pDONR201

pDONR201 in advanced viewed

Synonyms: None
Sequencing Primer: Forward:  pDONR201-forward
Reverse:  pDONR201-reverse
Description: Recombinational donor/master vector; kanamycin resistance; recombinational cloning.
Comments: The position of features were determined for the unrecombined (empty) form of the vector, which is described in detail on the Invitrogen website.
Size (bp): 4470
Parent Vector: None
Empty Vector: None
Properties: Gateway, donor (entry), recombinational cloning
Author Name: Invitrogen
Publications: None
Vector Map:         Vector Sequence:
Sequence:

 



Vector Features:

Type Name Description Start Position End Position
bacterial origin ColE ColE1 (pUC-type) origin of replication (modified, low copy number) 3744 4426
negative selection marker ccdB ccdB negative selection gene (death cassette), LOST in recombined (with insert) form 1264 959
primer site forward primer recommended forward primer site 5 tcgcgttaacgctagcatggatctc 3 300 324
primer site reverse primer recommended reverse primer site 5 gtaacatcagagattttgagacac 3 2769 2792
recombination site attL2 attL recombination site 2 present in recombined (with insert) form only, position is approximate 2744 2513
recombination site attP1 attP recombination site 1 LOST in recombined (with insert) form 332 563
recombination site attP2 attP recombination site 2 LOST in recombined (with insert) form 2744 2513
recombination site attL1 attL recombination site 1 present in recombined (with insert) form only, position is approximate 332 563
selectable marker CmR chloramphenicol resistance gene, LOST in recombined (with insert) form 2265 2513
selectable marker KanR kanamycin resistance gene 2868 3677
trxn termination sequence rrn T2 rrn T2 transcription termination sequence 73 100
trxn termination sequence rrn T1 rrn T1 transcription termination sequence 232 275

 

  • Gene
  • Pathways
  • Protein
  • Clone
  • Organism
  • Genome
  • Reagents

Gene

 

Gene Symbol : CDK4
Symbol Nomenclature : CDK4
SYNONYM : CMM3; PSK-J3
Designation : cell division protein kinase 4
Full Nomenclature : cyclin-dependent kinase 4
GENEID : 1019
GI : 60829204
GenBank Accession : AY893833
HGNC : 1773
MIM : 123829
Vega : OTTHUMG00000170382
Target GenBank: NM_000075

 

Reference Sequence Alignment

  

HsCD00001470      ATGGCTACCTCTCGATATGAGCCAGTGGCTGAAATTGGTGTCGGTGCCTATGGGACAGTG
NM_000075.3       ATGGCTACCTCTCGATATGAGCCAGTGGCTGAAATTGGTGTCGGTGCCTATGGGACAGTG
                  ************************************************************

HsCD00001470      TACAAGGCCCGTGATCCCCACAGTGGCCACTTTGTGGCCCTCAAGAGTGTGAGAGTCCCC
NM_000075.3       TACAAGGCCCGTGATCCCCACAGTGGCCACTTTGTGGCCCTCAAGAGTGTGAGAGTCCCC
                  ************************************************************

HsCD00001470      AATGGAGGAGGAGGTGGAGGAGGCCTTCCCATCAGCACAGTTCGTGAGGTGGCTTTACTG
NM_000075.3       AATGGAGGAGGAGGTGGAGGAGGCCTTCCCATCAGCACAGTTCGTGAGGTGGCTTTACTG
                  ************************************************************

HsCD00001470      AGGCGACTGGAGGCTTTTGAGCATCCCAATGTTGTCCGGCTGATGGACGTCTGTGCCACA
NM_000075.3       AGGCGACTGGAGGCTTTTGAGCATCCCAATGTTGTCCGGCTGATGGACGTCTGTGCCACA
                  ************************************************************

HsCD00001470      TCCCGAACTGACCGGGAGATCAGGGTAACCCTGGTGTTTGAGCATGTAGACCAGGACCTA
NM_000075.3       TCCCGAACTGACCGGGAGATCAAGGTAACCCTGGTGTTTGAGCATGTAGACCAGGACCTA
                  **********************.*************************************

HsCD00001470      AGGACATATCTGGACAAGGCACCCCCACCAGGCTTGCCAGCCGAAACGATCAAGGATCTG
NM_000075.3       AGGACATATCTGGACAAGGCACCCCCACCAGGCTTGCCAGCCGAAACGATCAAGGATCTG
                  ************************************************************

HsCD00001470      ATGCGCCAGTTTCTAAGAGGCCTAGATTTCCTTCATGCCAATTGCATCGTTCACCGAGAT
NM_000075.3       ATGCGCCAGTTTCTAAGAGGCCTAGATTTCCTTCATGCCAATTGCATCGTTCACCGAGAT
                  ************************************************************

HsCD00001470      CTGAAGCCAGAGAACATTCTGGTGACAAGTGGTGGAACAGTCAAGCTGGCTGACTTTGGC
NM_000075.3       CTGAAGCCAGAGAACATTCTGGTGACAAGTGGTGGAACAGTCAAGCTGGCTGACTTTGGC
                  ************************************************************

HsCD00001470      CTGGCCAGAATCTACAGCTACCAGATGGCACTTACACCCGTGGTTGTTACACTCTGGTAC
NM_000075.3       CTGGCCAGAATCTACAGCTACCAGATGGCACTTACACCCGTGGTTGTTACACTCTGGTAC
                  ************************************************************

HsCD00001470      CGAGCTCCCGAAGTTCTTCTGCAGTCCACATATGCAACACCTGTGGACATGTGGAGTGTT
NM_000075.3       CGAGCTCCCGAAGTTCTTCTGCAGTCCACATATGCAACACCTGTGGACATGTGGAGTGTT
                  ************************************************************

HsCD00001470      GGCTGTATCTTTGCAGAGATGTTTCGTCGAAAGCCTCTCTTCTGTGGAAACTCTGAAGCC
NM_000075.3       GGCTGTATCTTTGCAGAGATGTTTCGTCGAAAGCCTCTCTTCTGTGGAAACTCTGAAGCC
                  ************************************************************

HsCD00001470      GACCAGTTGGGCAAAATCTTTGACCTGATTGGGCTGCCTCCAGAGGATGACTGGCCTCGA
NM_000075.3       GACCAGTTGGGCAAAATCTTTGACCTGATTGGGCTGCCTCCAGAGGATGACTGGCCTCGA
                  ************************************************************

HsCD00001470      GATGTATCCCTGCCCCGTGGAGCCTTTCCCCCCAGAGGGCCCCGCCCAGTGCAGTCGGTG
NM_000075.3       GATGTATCCCTGCCCCGTGGAGCCTTTCCCCCCAGAGGGCCCCGCCCAGTGCAGTCGGTG
                  ************************************************************

HsCD00001470      GTACCTGAGATGGAGGAGTCGGGAGCACAGCTGCTGCTGGAAATGCTGACTTTTAACCCA
NM_000075.3       GTACCTGAGATGGAGGAGTCGGGAGCACAGCTGCTGCTGGAAATGCTGACTTTTAACCCA
                  ************************************************************

HsCD00001470      CACAAGCGAATCTCTGCCTTTCGAGCTCTGCAGCACTCTTATCTACATAAGGATGAAGGT
NM_000075.3       CACAAGCGAATCTCTGCCTTTCGAGCTCTGCAGCACTCTTATCTACATAAGGATGAAGGT
                  ************************************************************

HsCD00001470      AATCCGGAGTTG
NM_000075.3       AATCCGGAGTGA
                  ********** .

Pathways

NCI : ATF-2 transcription factor network
NCI : Calcineurin-regulated NFAT-dependent transcription in lymphocytes
NCI : FOXM1 transcription factor network
NCI : Regulation of nuclear SMAD2/3 signaling
NCI : Regulation of retinoblastoma protein
NCI : Validated targets of C-MYC transcriptional activation
Reactome : Cell Cycle
Reactome : Cell Cycle, Mitotic
Reactome : Cellular Senescence
Reactome : Cellular responses to stress
Reactome : Cyclin D associated events in G1
Reactome : Developmental Biology
Reactome : G1 Phase
Reactome : Meiosis
Reactome : Meiotic recombination
Reactome : Mitotic G1-G1/S phases
Reactome : Oncogene Induced Senescence
Reactome : Oxidative Stress Induced Senescence
Reactome : S Phase
Reactome : Senescence-Associated Secretory Phenotype (SASP)
Reactome : Transcriptional regulation of white adipocyte differentiation
Reactome : Ubiquitin-dependent degradation of Cyclin D
Reactome : Ubiquitin-dependent degradation of Cyclin D1
WikiPathway : Cell cycle
WikiPathway : DNA damage response
WikiPathway : G1 to S cell cycle control
WikiPathway : Integrated Breast Cancer Pathway
WikiPathway : Integrated Cancer pathway
WikiPathway : Ovarian Infertility Genes
WikiPathway : TSH signaling pathway
WikiPathway : miRNA regulation of DNA Damage Response

Clone

Cloning Information : 56457
HIP Master Clone ID : 34745
Original Clone ID : FLH056457.01L

Organism


TAX_ID : 9606
Species Specific ID: 1019

Genome

Chromosome : 12
Map Location : 12q14
Ensembl : ENSG00000135446

Reagents

Labome : Cdk4-antibody