DNASU Plasmid Repository • 480.965.5697 | Email

TCEB1 (Homo sapiens) in pDNR-Dual (Creator donor/master vector)

TOP

Explanation of Terms


Gene: Gene Symbol:  TCEB1
Gene Name:  transcription elongation factor B (SIII), polypeptide 1 (15kDa, elongin C)
Sequence              Map: pDNR-Dual_with_human_insert.pdf
Original Clone ID: FLH010046.01L
Keyword: None
Species: Homo sapiens
Type: cDNA
Vector Name: pDNR-Dual               Format:  FUSION
Source: HIP
Description: None
Comments: None
Mutation/
Discrepancy :
No / No
Publications: None
Authors: HIP
HsCD00001536

Price:  Login for Pricing
AVAILABLE
No restriction
Special MTA: None

 

Insert sequence: 339nts         Open reading frame : 1 to 339
Reference Sequence Alignment

ATGGATGGAGAGGAGAAAACCTATGGTGGCTGTGAAGGACCTGATGCCATGTATGTCAAA
TTGATATCATCTGATGGCCATGAATTTATTGTAAAAAGAGAACATGCATTAACATCAGGC
ACGATAAAAGCCATGTTGAGTGGCCCAGGTCAGTTTGCTGAGAACGAAACCAATGAGGTC
AATTTTAGAGAGATACCTTCACATGTGCTATCGAAAGTATGCATGTATTTTACGTACAAG
GTTCGCTACACTAACAGCTCCACCGAGATTCCTGAATTCCCAATTGCACCTGAAATTGCA
CTGGAACTGCTGATGGCTGCGAACTTCTTAGATTGTTTG


Coding Sequence Details
Insert Sequence Verified?: Y Verification Method: Sequence Verification
Reference Sequence Annotations:
End on reference sequence 426
Start on reference sequence 88
Mutations:
None
Discrepancy:
None
5' Linker Sequence:
5P GCGGCCGCATAACTTCGTATAGCATACATTATACGAAGTTATCAGTC
GACACC(ATG-GOI)

3' Linker Sequence:
5p (goi-stop)GGAAGCTTTCTAGACCATTCGTTTGGCGCGCGGGCCC

 

 Recommended Growth Condition:

Distributed in bacterial strain : DH5-alpha T1 phage resistant
Antibiotic Selection: Host Type:  bacterial    Marker:  ampicillin
Bacterial Selection Condition:  100 ug/mL ampicillin
Growth Condition:  Growth with the single antibiotic in LB at 37 degrees is recommended.
Comments:  Commonly used conditions for ampicillin resistant plasmid clones.
Protein Expression Results: None
Recommended expression in: Not Applicable
       DyNA Vector Map

         Powered by LabGenius

Vector Name: pDNR-Dual

pDNR-Dual in advanced viewed

Synonyms: None
Sequencing Primer: Forward:  M13F
Reverse:  Unknown
Description: Recombinational donor/master vector with 6xHN tag ORF, T7 and M13 primer sites; ampicillin resistance; restriction enzyme cloning (into) and recombinational cloning (from).
Comments: The position of features were detemined for the empty form of the vector, which is described in detail on the BD/Clontech website. Subcloning into the MCS was performed using the infusion reaction strategy and some restriction sites in the MCS may be lost after an insert is added.
Size (bp): 4938
Parent Vector: None
Empty Vector: None
Properties: Creator, donor (entry), loxP, multiple cloning site, recombinational cloning, with tag/fusion/marker
Author Name: BD Biosciences Clontech
Publications: None
Vector Map:         Vector Sequence:
Sequence:

 



Vector Features:

Type Name Description Start Position End Position
MCS MCS restriction enzyme-type multiple cloning site 45 129
bacterial origin ColE1 ColE1 (pUC-type) origin of replication 4111 4574
negative selection marker SacB SacB negative selection marker gene (sucrose sensitivity) 1057 2972
primer site M13 primer M13 primer sequencing site 4839 4855
primer site T7 primer T7 RNA Pol primer sequencing site 4865 4883
recombination site loxP site loxP recombination site 1015 1048
recombination site loxP site loxP recombination site 9 42
selectable marker CmR chloramphenicol resistance gene ORF (functional only after recombination of insert into vector with promoter) 986 327
selectable marker AmpR ampicillin resistance gene 3103 3963
splice donor site SD site splice donor site 132 136
tag HN 6xHN epitope tag 141 176

 

  • Gene
  • Pathways
  • Protein
  • Clone
  • Organism
  • Genome
  • Reagents

Gene

 

Gene Symbol : TCEB1
Symbol Nomenclature : TCEB1
SYNONYM : SIII; eloC
Designation : RNA polymerase II transcription factor SIII subunit C|SIII p15|elongin 15 kDa subunit|transcription elongation factor B polypeptide 1
Full Nomenclature : transcription elongation factor B (SIII), polypeptide 1 (15kDa, elongin C)
GENEID : 6921
GI : 61368794
GenBank Accession : AY891311
HGNC : 11617
MIM : 600788
Vega : OTTHUMG00000164501
Target GenBank: NM_005648

 

Reference Sequence Alignment

  

HsCD00001536        ATGGATGGAGAGGAGAAAACCTATGGTGGCTGTGAAGGACCTGATGCCATGTATGTCAAA
NM_001204859.1      ATGGATGGAGAGGAGAAAACCTATGGTGGCTGTGAAGGACCTGATGCCATGTATGTCAAA
NM_001204860.1      ATGGATGGAGAGGAGAAAACCTATGGTGGCTGTGAAGGACCTGATGCCATGTATGTCAAA
NM_001204858.1      ATGGATGGAGAGGAGAAAACCTATGGTGGCTGTGAAGGACCTGATGCCATGTATGTCAAA
NM_001204857.1      ATGGATGGAGAGGAGAAAACCTATGGTGGCTGTGAAGGACCTGATGCCATGTATGTCAAA
NM_001204861.1      ATGGATGGAGAGGAGAAAACCTATGGTGGCTGTGAAGGACCTGATGCCATGTATGTCAAA
NM_001204862.1      ATGGATGGAGAGGAGAAAACCTATGGTGGCTGTGAAGGACCTGATGCCATGTATGTCAAA
NM_005648.3         ATGGATGGAGAGGAGAAAACCTATGGTGGCTGTGAAGGACCTGATGCCATGTATGTCAAA
                    ************************************************************

HsCD00001536        TTGATATCATCTGATGGCCATGAATTTATTGTAAAAAGAGAACATGCATTAACATCAGGC
NM_001204859.1      TTGATATCATCTGATGGCCATGAATTTATTGTAAAAAGAGAACATGCATTAACATCAGGC
NM_001204860.1      TTGATATCATCTGATGGCCATGAATTTATTGTAAAAAGAGAACATGCATTAACATCAGGC
NM_001204858.1      TTGATATCATCTGATGGCCATGAATTTATTGTAAAAAGAGAACATGCATTAACATCAGGC
NM_001204857.1      TTGATATCATCTGATGGCCATGAATTTATTGTAAAAAGAGAACATGCATTAACATCAGGC
NM_001204861.1      TTGATATCATCTGATGGCCATGAATTTATTGTAAAAAGAGAACATGCATTAACATCAGGC
NM_001204862.1      TTGATATCATCTGATGGCCATGAATTTATTGTAAAAAGAGAACATGCATTAACATCAGGC
NM_005648.3         TTGATATCATCTGATGGCCATGAATTTATTGTAAAAAGAGAACATGCATTAACATCAGGC
                    ************************************************************

HsCD00001536        ACGATAAAAGCCATGTTGAGTGGCCCAGGTCAGTTTGCTGAGAACGAAACCAATGAGGTC
NM_001204859.1      ACGATAAAAGCCATGTTGAGTGGCCCAGGTCAGTTTGCTGAGAACGAAACCAATGAGGTC
NM_001204860.1      ACGATAAAAGCCATGTTGAGTGGCCCAGGTCAGTTTGCTGAGAACGAAACCAATGAGGTC
NM_001204858.1      ACGATAAAAGCCATGTTGAGTGGCCCAGGTCAGTTTGCTGAGAACGAAACCAATGAGGTC
NM_001204857.1      ACGATAAAAGCCATGTTGAGTGGCCCAGGTCAGTTTGCTGAGAACGAAACCAATGAGGTC
NM_001204861.1      ACGATAAAAGCCATGTTGAGTGGCCCAGGTCAGTTTGCTGAGAACGAAACCAATGAGGTC
NM_001204862.1      ACGATAAAAGCCATGTTGAGTGGCCCAGGTCAGTTTGCTGAGAACGAAACCAATGAGGTC
NM_005648.3         ACGATAAAAGCCATGTTGAGTGGCCCAGGTCAGTTTGCTGAGAACGAAACCAATGAGGTC
                    ************************************************************

HsCD00001536        AATTTTAGAGAGATACCTTCACATGTGCTATCGAAAGTATGCATGTATTTTACGTACAAG
NM_001204859.1      AATTTTAGAGAGATACCTTCACATGTGCTATCGAAAGTATGCATGTATTTTACGTACAAG
NM_001204860.1      AATTTTAGAGAGATACCTTCACATGTGCTATCGAAAGTATGCATGTATTTTACGTACAAG
NM_001204858.1      AATTTTAGAGAGATACCTTCACATGTGCTATCGAAAGTATGCATGTATTTTACGTACAAG
NM_001204857.1      AATTTTAGAGAGATACCTTCACATGTGCTATCGAAAGTATGCATGTATTTTACGTACAAG
NM_001204861.1      AATTTTAGAGAGATACCTTCACATGTGCTATCGAAAGTATGCATGTATTTTACGTACAAG
NM_001204862.1      AATTTTAGAGAGATACCTTCACATGTGCTATCGAAAGTATGCATGTATTTTACGTACAAG
NM_005648.3         AATTTTAGAGAGATACCTTCACATGTGCTATCGAAAGTATGCATGTATTTTACGTACAAG
                    ************************************************************

HsCD00001536        GTTCGCTACACTAACAGCTCCACCGAGATTCCTGAATTCCCAATTGCACCTGAAATTGCA
NM_001204859.1      GTTCGCTACACTAACAGCTCCACCGAGATTCCTGAATTCCCAATTGCACCTGAAATTGCA
NM_001204860.1      GTTCGCTACACTAACAGCTCCACCGAGATTCCTGAATTCCCAATTGCACCTGAAATTGCA
NM_001204858.1      GTTCGCTACACTAACAGCTCCACCGAGATTCCTGAATTCCCAATTGCACCTGAAATTGCA
NM_001204857.1      GTTCGCTACACTAACAGCTCCACCGAGATTCCTGAATTCCCAATTGCACCTGAAATTGCA
NM_001204861.1      GTTCGCTACACTAACAGCTCCACCGAGATTCCTGAATTCCCAATTGCACCTGAAATTGCA
NM_001204862.1      GTTCGCTACACTAACAGCTCCACCGAGATTCCTGAATTCCCAATTGCACCTGAAATTGCA
NM_005648.3         GTTCGCTACACTAACAGCTCCACCGAGATTCCTGAATTCCCAATTGCACCTGAAATTGCA
                    ************************************************************

HsCD00001536        CTGGAACTGCTGATGGCTGCGAACTTCTTAGATTGTTTG
NM_001204859.1      CTGGAACTGCTGATGGCTGCGAACTTCTTAGATTGTTAA
NM_001204860.1      CTGGAACTGCTGATGGCTGCGAACTTCTTAGATTGTTAA
NM_001204858.1      CTGGAACTGCTGATGGCTGCGAACTTCTTAGATTGTTAA
NM_001204857.1      CTGGAACTGCTGATGGCTGCGAACTTCTTAGATTGTTAA
NM_001204861.1      CTGGAACTGCTGATGGCTGCGAACTTCTTAGATTGTTAA
NM_001204862.1      CTGGAACTGCTGATGGCTGCGAACTTCTTAGATTGTTAA
NM_005648.3         CTGGAACTGCTGATGGCTGCGAACTTCTTAGATTGTTAA
                    *************************************:.

Pathways

NCI : HIF-2-alpha transcription factor network
NCI : Hypoxic and oxygen homeostasis regulation of HIF-1-alpha
Reactome : Adaptive Immune System
Reactome : Antigen processing: Ubiquitination & Proteasome degradation
Reactome : Cellular response to hypoxia
Reactome : Cellular responses to stress
Reactome : Class I MHC mediated antigen processing & presentation
Reactome : Disease
Reactome : Elongation arrest and recovery
Reactome : Formation of HIV elongation complex in the absence of HIV Tat
Reactome : Formation of HIV-1 elongation complex containing HIV-1 Tat
Reactome : Formation of RNA Pol II elongation complex
Reactome : Gene Expression
Reactome : HIV Infection
Reactome : HIV Life Cycle
Reactome : HIV Transcription Elongation
Reactome : HIV elongation arrest and recovery
Reactome : Host Interactions of HIV factors
Reactome : Immune System
Reactome : Late Phase of HIV Life Cycle
Reactome : Oxygen-dependent proline hydroxylation of Hypoxia-inducible Factor Alpha
Reactome : Pausing and recovery of HIV elongation
Reactome : Pausing and recovery of Tat-mediated HIV elongation
Reactome : RNA Polymerase II Pre-transcription Events
Reactome : RNA Polymerase II Transcription
Reactome : RNA Polymerase II Transcription Elongation
Reactome : Regulation of Hypoxia-inducible Factor (HIF) by oxygen
Reactome : Tat-mediated HIV elongation arrest and recovery
Reactome : Tat-mediated elongation of the HIV-1 transcript
Reactome : Transcription
Reactome : Transcription of the HIV genome
Reactome : Vif-mediated degradation of APOBEC3G

Protein

SMART domain : Skp1 : Found in Skp1 protein family
UniProt : E5RGD9
UniProt : Q15369
HPRD : 02875

Clone

Cloning Information : 10046
HIP Master Clone ID : 14108
Original Clone ID : FLH010046.01L

Organism


TAX_ID : 9606
Species Specific ID: 6921

Genome

Chromosome : 8
Map Location : 8q21.11
Ensembl : ENSG00000154582

Reagents

Labome : TCEB1-antibody