DNASU Plasmid Repository • 480.965.5697 | Email

CDK9 (Homo sapiens) in pDNR-Dual (Creator donor/master vector)

TOP

Explanation of Terms


Gene: Gene Symbol:  CDK9
Gene Name:  cyclin-dependent kinase 9
Sequence              Map: pDNR-Dual_with_human_insert.pdf
Original Clone ID: FLH010279.01L
Keyword: None
Species: Homo sapiens
Type: cDNA
Vector Name: pDNR-Dual               Format:  FUSION
Source: HIP
Description: None
Comments: None
Mutation/
Discrepancy :
No / Yes
Publications: PMID: 15928075
Title: Building a human kinase gene repository: bioinformatics, molecular cloning, and functional validation.
Authors: HIP
HsCD00001572

Price:  Login for Pricing
AVAILABLE
No restriction
Special MTA: None

 

Insert sequence: 1119nts        
Open reading frame : 1 to 1119
Reference Sequence Alignment

ATGGCAAAGCAGTACGACTCGGTGGAGTGCCCTTTTTGTGATGAAGTTTCCAAATACGAG
AAGCTCGCCAAGATCGGCCAAGGCACCTTCGGGGAGGTGTTCAAGGCCAGGCACCGCAAG
ACCGGCCAGAAGGTGGCTCTGAAGAAGGTGCTGATGGAAAACGAGAAGGAGGGGTTCCCC
ATTACAGCCTTGCGGGAGATCAAGATCCTTCAGCTTCTAAAACACGAGAATGTGGTCAAC
TTGATTGAGATTTGTCGAACCAAAGCTTCCCCCTATAACCGCTGCAAGGGTAGTATATAC
CTGGTGTTCGACTTCTGCGAGCATGACCTTGCTGGGCTGTTGAGCAATGTTTTGGTCAAG
TTCACGTTGTCTGAGATCAAGAGGGTGATGCAGATGCTGCTTAACGGCCTCTACTACATC
CACAGAAACAAGATCCTGCATAGGGACATGAAGGCTGCTAATGTGCTTATCACTCGTGAT
GGGGTCCTGAAGCTGGCAGACTTTGGGCTGGCCCGGGCCTTCAGCCTGGCCAAGAACAGC
CAGCCCAACCGCTACACCAACCGTGTGGTGACACTCTGGTACCGGCCCCCGGAGCTGTTG
CTCGGGGAGCGGGACTACGGCCCCCCCATTGACCTGTGGGGTGCTGGGTGCATCATGGCA
GAGATGTGGACCCGCAGCCCCATCATGCAGGGCAACACGGAGCAGCACCAACTCGCCCTC
ATCAGTCAGCTCTGCGGCTCCATCACCCCTGAGGTGTGGCCAAACGTGGACAACTATGAG
CTGTACGAAAAGCTGGAGCTGGTCAAGGGCCAGAAGCGGAAGGTGAAGGACAGGCTGAAG
GCCTATGTGCGTGACCCATACGCACTGGACCTCATCGACAAGCTGCTGGTGCTGGACCCT
GCCCAGCGCATCGACAGCGATGACGCCCTCAACCACGACTTCTTCTGGTCCGACCCCATG
CCCTCCGACCTCAAGGGCATGCTCTCCACCCACCTGACGTCCATGTTCGAGTACTTGGCA
CCACCGCGCCGGAAGGGCAGCCAGATCACCCAGCAGTCCACCAACCAGAGTCGCAATCCC
GCCACCACCAACCAGACGGAGTTTGAGCGCGTCTTCTTG


Coding Sequence Details
Insert Sequence Verified?: Y Verification Method: Sequence Verification
Reference Sequence Annotations:
End on reference sequence 1183
Start on reference sequence 65
Mutations:
None
Discrepancy:
c367t
                                

5' Linker Sequence:
5P GCGGCCGCATAACTTCGTATAGCATACATTATACGAAGTTATCAGTC
GACACC(ATG-GOI)

3' Linker Sequence:
5p (goi-stop)GGAAGCTTTCTAGACCATTCGTTTGGCGCGCGGGCCC

 

 Recommended Growth Condition:

Distributed in bacterial strain : DH5-alpha T1 phage resistant
Antibiotic Selection: Host Type:  bacterial    Marker:  ampicillin
Bacterial Selection Condition:  100 ug/mL ampicillin
Growth Condition:  Growth with the single antibiotic in LB at 37 degrees is recommended.
Comments:  Commonly used conditions for ampicillin resistant plasmid clones.
Protein Expression Results: None
Recommended expression in: Not Applicable
       DyNA Vector Map

         Powered by LabGenius

Vector Name: pDNR-Dual

pDNR-Dual in advanced viewed

Synonyms: ''
Sequencing Primer: Forward:  M13F
Reverse:  Unknown
Description: Recombinational donor/master vector with 6xHN tag ORF, T7 and M13 primer sites; ampicillin resistance; restriction enzyme cloning (into) and recombinational cloning (from).
Comments: The position of features were detemined for the empty form of the vector, which is described in detail on the BD/Clontech website. Subcloning into the MCS was performed using the infusion reaction strategy and some restriction sites in the MCS may be lost after an insert is added.
Size (bp): 4938
Parent Vector: None
Empty Vector: None
Properties: Creator, donor (entry), loxP, multiple cloning site, recombinational cloning, with tag/fusion/marker
Author Name: BD Biosciences Clontech
Publications: None
Vector Map:         Vector Sequence:
Sequence:

 



Vector Features:

Type Name Description Start Position End Position
MCS MCS restriction enzyme-type multiple cloning site 45 129
bacterial origin ColE1 ColE1 (pUC-type) origin of replication 4111 4574
negative selection marker SacB SacB negative selection marker gene (sucrose sensitivity) 1057 2972
primer site M13 primer M13 primer sequencing site 4839 4855
primer site T7 primer T7 RNA Pol primer sequencing site 4865 4883
recombination site loxP site loxP recombination site 9 42
recombination site loxP site loxP recombination site 1015 1048
selectable marker CmR chloramphenicol resistance gene ORF (functional only after recombination of insert into vector with promoter) 986 327
selectable marker AmpR ampicillin resistance gene 3103 3963
splice donor site SD site splice donor site 132 136
tag HN 6xHN epitope tag 141 176

 

  • Gene
  • Pathways
  • Protein
  • Clone
  • Organism
  • Genome
  • Reagents

Gene

 

Gene Symbol : CDK9
Symbol Nomenclature : CDK9
SYNONYM : C-2k; CDC2L4; CTK1; PITALRE; TAK
Designation : CDC2-related kinase|cell division cycle 2-like protein kinase 4|cell division protein kinase 9|serine/threonine protein kinase PITALRE|serine/threonine-protein kinase PITALRE|tat-associated kinase complex catalytic subunit
Full Nomenclature : cyclin-dependent kinase 9
GENEID : 1025
Locus Tag : RP11-228B15.5
GI : 61368897
GenBank Accession : AY891328
HGNC : 1780
MIM : 603251
Vega : OTTHUMG00000020715
Target GenBank: NM_001261

 

Reference Sequence Alignment

  

HsCD00001572      ATGGCAAAGCAGTACGACTCGGTGGAGTGCCCTTTTTGTGATGAAGTTTCCAAATACGAG
NM_001261.3       ATGGCAAAGCAGTACGACTCGGTGGAGTGCCCTTTTTGTGATGAAGTTTCCAAATACGAG
                  ************************************************************

HsCD00001572      AAGCTCGCCAAGATCGGCCAAGGCACCTTCGGGGAGGTGTTCAAGGCCAGGCACCGCAAG
NM_001261.3       AAGCTCGCCAAGATCGGCCAAGGCACCTTCGGGGAGGTGTTCAAGGCCAGGCACCGCAAG
                  ************************************************************

HsCD00001572      ACCGGCCAGAAGGTGGCTCTGAAGAAGGTGCTGATGGAAAACGAGAAGGAGGGGTTCCCC
NM_001261.3       ACCGGCCAGAAGGTGGCTCTGAAGAAGGTGCTGATGGAAAACGAGAAGGAGGGGTTCCCC
                  ************************************************************

HsCD00001572      ATTACAGCCTTGCGGGAGATCAAGATCCTTCAGCTTCTAAAACACGAGAATGTGGTCAAC
NM_001261.3       ATTACAGCCTTGCGGGAGATCAAGATCCTTCAGCTTCTAAAACACGAGAATGTGGTCAAC
                  ************************************************************

HsCD00001572      TTGATTGAGATTTGTCGAACCAAAGCTTCCCCCTATAACCGCTGCAAGGGTAGTATATAC
NM_001261.3       TTGATTGAGATTTGTCGAACCAAAGCTTCCCCCTATAACCGCTGCAAGGGTAGTATATAC
                  ************************************************************

HsCD00001572      CTGGTGTTCGACTTCTGCGAGCATGACCTTGCTGGGCTGTTGAGCAATGTTTTGGTCAAG
NM_001261.3       CTGGTGTTCGACTTCTGCGAGCATGACCTTGCTGGGCTGTTGAGCAATGTTTTGGTCAAG
                  ************************************************************

HsCD00001572      TTCACGTTGTCTGAGATCAAGAGGGTGATGCAGATGCTGCTTAACGGCCTCTACTACATC
NM_001261.3       TTCACGCTGTCTGAGATCAAGAGGGTGATGCAGATGCTGCTTAACGGCCTCTACTACATC
                  ****** *****************************************************

HsCD00001572      CACAGAAACAAGATCCTGCATAGGGACATGAAGGCTGCTAATGTGCTTATCACTCGTGAT
NM_001261.3       CACAGAAACAAGATCCTGCATAGGGACATGAAGGCTGCTAATGTGCTTATCACTCGTGAT
                  ************************************************************

HsCD00001572      GGGGTCCTGAAGCTGGCAGACTTTGGGCTGGCCCGGGCCTTCAGCCTGGCCAAGAACAGC
NM_001261.3       GGGGTCCTGAAGCTGGCAGACTTTGGGCTGGCCCGGGCCTTCAGCCTGGCCAAGAACAGC
                  ************************************************************

HsCD00001572      CAGCCCAACCGCTACACCAACCGTGTGGTGACACTCTGGTACCGGCCCCCGGAGCTGTTG
NM_001261.3       CAGCCCAACCGCTACACCAACCGTGTGGTGACACTCTGGTACCGGCCCCCGGAGCTGTTG
                  ************************************************************

HsCD00001572      CTCGGGGAGCGGGACTACGGCCCCCCCATTGACCTGTGGGGTGCTGGGTGCATCATGGCA
NM_001261.3       CTCGGGGAGCGGGACTACGGCCCCCCCATTGACCTGTGGGGTGCTGGGTGCATCATGGCA
                  ************************************************************

HsCD00001572      GAGATGTGGACCCGCAGCCCCATCATGCAGGGCAACACGGAGCAGCACCAACTCGCCCTC
NM_001261.3       GAGATGTGGACCCGCAGCCCCATCATGCAGGGCAACACGGAGCAGCACCAACTCGCCCTC
                  ************************************************************

HsCD00001572      ATCAGTCAGCTCTGCGGCTCCATCACCCCTGAGGTGTGGCCAAACGTGGACAACTATGAG
NM_001261.3       ATCAGTCAGCTCTGCGGCTCCATCACCCCTGAGGTGTGGCCAAACGTGGACAACTATGAG
                  ************************************************************

HsCD00001572      CTGTACGAAAAGCTGGAGCTGGTCAAGGGCCAGAAGCGGAAGGTGAAGGACAGGCTGAAG
NM_001261.3       CTGTACGAAAAGCTGGAGCTGGTCAAGGGCCAGAAGCGGAAGGTGAAGGACAGGCTGAAG
                  ************************************************************

HsCD00001572      GCCTATGTGCGTGACCCATACGCACTGGACCTCATCGACAAGCTGCTGGTGCTGGACCCT
NM_001261.3       GCCTATGTGCGTGACCCATACGCACTGGACCTCATCGACAAGCTGCTGGTGCTGGACCCT
                  ************************************************************

HsCD00001572      GCCCAGCGCATCGACAGCGATGACGCCCTCAACCACGACTTCTTCTGGTCCGACCCCATG
NM_001261.3       GCCCAGCGCATCGACAGCGATGACGCCCTCAACCACGACTTCTTCTGGTCCGACCCCATG
                  ************************************************************

HsCD00001572      CCCTCCGACCTCAAGGGCATGCTCTCCACCCACCTGACGTCCATGTTCGAGTACTTGGCA
NM_001261.3       CCCTCCGACCTCAAGGGCATGCTCTCCACCCACCTGACGTCCATGTTCGAGTACTTGGCA
                  ************************************************************

HsCD00001572      CCACCGCGCCGGAAGGGCAGCCAGATCACCCAGCAGTCCACCAACCAGAGTCGCAATCCC
NM_001261.3       CCACCGCGCCGGAAGGGCAGCCAGATCACCCAGCAGTCCACCAACCAGAGTCGCAATCCC
                  ************************************************************

HsCD00001572      GCCACCACCAACCAGACGGAGTTTGAGCGCGTCTTCTTG
NM_001261.3       GCCACCACCAACCAGACGGAGTTTGAGCGCGTCTTCTGA
                  ************************************* .

Pathways

Reactome : Disease
Reactome : Elongation arrest and recovery
Reactome : Formation of HIV elongation complex in the absence of HIV Tat
Reactome : Formation of HIV-1 elongation complex containing HIV-1 Tat
Reactome : Formation of RNA Pol II elongation complex
Reactome : Gene Expression
Reactome : Generic Transcription Pathway
Reactome : HIV elongation arrest and recovery
Reactome : HIV Infection
Reactome : HIV Life Cycle
Reactome : HIV Transcription Elongation
Reactome : Host Interactions of HIV factors
Reactome : Interactions of Tat with host cellular proteins
Reactome : Late Phase of HIV Life Cycle
Reactome : Loss of Function of SMAD2/3 in Cancer
Reactome : Loss of Function of SMAD4 in Cancer
Reactome : Loss of Function of TGFBR1 in Cancer
Reactome : Loss of Function of TGFBR2 in Cancer
Reactome : Pausing and recovery of HIV elongation
Reactome : Pausing and recovery of Tat-mediated HIV elongation
Reactome : RNA Polymerase II Pre-transcription Events
Reactome : RNA Polymerase II Transcription
Reactome : RNA Polymerase II Transcription Elongation
Reactome : Signal Transduction
Reactome : Signaling by TGF-beta Receptor Complex
Reactome : Signaling by TGF-beta Receptor Complex in Cancer
Reactome : SMAD2/3 MH2 Domain Mutants in Cancer
Reactome : SMAD2/3 Phosphorylation Motif Mutants in Cancer
Reactome : SMAD2/SMAD3:SMAD4 heterotrimer regulates transcription
Reactome : SMAD4 MH2 Domain Mutants in Cancer
Reactome : Tat-mediated elongation of the HIV-1 transcript
Reactome : Tat-mediated HIV elongation arrest and recovery
Reactome : TGFBR1 KD Mutants in Cancer
Reactome : TGFBR1 LBD Mutants in Cancer
Reactome : TGFBR2 Kinase Domain Mutants in Cancer
Reactome : TGFBR2 MSI Frameshift Mutants in Cancer
Reactome : Transcription
Reactome : Transcription of the HIV genome
Reactome : Transcriptional activity of SMAD2/SMAD3:SMAD4 heterotrimer
WikiPathway : IL-9 signaling pathway
WikiPathway : MicroRNAs in cardiomyocyte hypertrophy

Clone

Cloning Information : 10279
HIP Master Clone ID : 14341
Original Clone ID : FLH010279.01L

Organism


TAX_ID : 9606
Species Specific ID: 1025

Genome

Chromosome : 9
Map Location : 9q34.1
Ensembl : ENSG00000136807

Reagents

Labome : cdk9-antibody