DNASU Plasmid Repository • 480.965.5697 | Email

SERPINE1 (Homo sapiens) in pDNR-Dual (Creator donor/master vector)

TOP

Explanation of Terms


Gene: Gene Symbol:  SERPINE1
Gene Name:  serpin peptidase inhibitor, clade E (nexin, plasminogen activator inhibitor type 1), member 1
Sequence              Map: pDNR-Dual_with_human_insert.pdf
Original Clone ID: FLH031026.01X
Keyword: None
Species: Homo sapiens
Type: cDNA
Vector Name: pDNR-Dual               Format:  CLOSED
Source: HIP
Description: None
Comments: None
Mutation/
Discrepancy :
No / No
Publications: PMID: 16512675
Title: Functional proteomics approach to investigate the biological activities of cDNAs implicated in breast cancer.
Authors: HIP
HsCD00001680

Price:  Login for Pricing
AVAILABLE
No restriction
Special MTA: None

 

Insert sequence: 1209nts         Open reading frame : 1 to 1209
Reference Sequence Alignment

ATGCAGATGTCTCCAGCCCTCACCTGCCTAGTCCTGGGCCTGGCCCTTGTCTTTGGTGAA
GGGTCTGCTGTGCACCATCCCCCATCCTACGTGGCCCACCTGGCCTCAGACTTCGGGGTG
AGGGTGTTTCAGCAGGTGGCGCAGGCCTCCAAGGACCGCAACGTGGTTTTCTCACCCTAT
GGGGTGGCCTCGGTGTTGGCCATGCTCCAGCTGACAACAGGAGGAGAAACCCAGCAGCAG
ATTCAAGCAGCTATGGGATTCAAGATTGATGACAAGGGCATGGCCCCCGCCCTCCGGCAT
CTGTACAAGGAGCTCATGGGGCCATGGAACAAGGATGAGATCAGCACCACAGACGCGATC
TTCGTCCAGCGGGATCTGAAGCTGGTCCAGGGCTTCATGCCCCACTTCTTCAGGCTGTTC
CGGAGCACGGTCAAGCAAGTGGACTTTTCAGAGGTGGAGAGAGCCAGATTCATCATCAAT
GACTGGGTGAAGACACACACAAAAGGTATGATCAGCAACTTGCTTGGGAAAGGAGCCGTG
GACCAGCTGACACGGCTGGTGCTGGTGAATGCCCTCTACTTCAACGGCCAGTGGAAGACT
CCCTTCCCCGACTCCAGCACCCACCGCCGCCTCTTCCACAAATCAGACGGCAGCACTGTC
TCTGTGCCCATGATGGCTCAGACCAACAAGTTCAACTATACTGAGTTCACCACGCCCGAT
GGCCATTACTACGACATCCTGGAACTGCCCTACCACGGGGACACCCTCAGCATGTTCATT
GCTGCCCCTTATGAAAAAGAGGTGCCTCTCTCTGCCCTCACCAACATTCTGAGTGCCCAG
CTCATCAGCCACTGGAAAGGCAACATGACCAGGCTGCCCCGCCTCCTGGTTCTGCCCAAG
TTCTCCCTGGAGACTGAAGTCGACCTCAGGAAGCCCCTAGAGAACCTGGGAATGACCGAC
ATGTTCAGACAGTTTCAGGCTGACTTCACGAGTCTTTCAGACCAAGAGCCTCTCCACGTC
GCGCAGGCGCTGCAGAAAGTGAAGATCGAGGTGAACGAGAGTGGCACGGTGGCCTCCTCA
TCCACAGCTGTCATAGTCTCAGCCCGCATGGCCCCCGAGGAGATCATCATGGACAGACCC
TTCCTCTTTGTGGTCCGGCACAACCCCACAGGAACAGTCCTTTTCATGGGCCAAGTGATG
GAACCCTGA


Coding Sequence Details
Insert Sequence Verified?: Y Verification Method: Sequence Verification
Reference Sequence Annotations:
End on reference sequence 1331
Start on reference sequence 123
Mutations:
None
Discrepancy:
None
5' Linker Sequence:
5P GCGGCCGCATAACTTCGTATAGCATACATTATACGAAGTTATCAGTC
GACACC(ATG-GOI)

3' Linker Sequence:
5p (goi-stop)GGAAGCTTTCTAGACCATTCGTTTGGCGCGCGGGCCC

 

 Recommended Growth Condition:

Distributed in bacterial strain : DH5-alpha T1 phage resistant
Antibiotic Selection: Host Type:  bacterial    Marker:  ampicillin
Bacterial Selection Condition:  100 ug/mL ampicillin
Growth Condition:  Growth with the single antibiotic in LB at 37 degrees is recommended.
Comments:  Commonly used conditions for ampicillin resistant plasmid clones.
Protein Expression Results: None
Recommended expression in: Not Applicable
       DyNA Vector Map

         Powered by LabGenius

Vector Name: pDNR-Dual

pDNR-Dual in advanced viewed

Synonyms: None
Sequencing Primer: Forward:  M13F
Reverse:  Unknown
Description: Recombinational donor/master vector with 6xHN tag ORF, T7 and M13 primer sites; ampicillin resistance; restriction enzyme cloning (into) and recombinational cloning (from).
Comments: The position of features were detemined for the empty form of the vector, which is described in detail on the BD/Clontech website. Subcloning into the MCS was performed using the infusion reaction strategy and some restriction sites in the MCS may be lost after an insert is added.
Size (bp): 4938
Parent Vector: None
Empty Vector: None
Properties: Creator, donor (entry), loxP, multiple cloning site, recombinational cloning, with tag/fusion/marker
Author Name: BD Biosciences Clontech
Publications: None
Vector Map:         Vector Sequence:
Sequence:

 



Vector Features:

Type Name Description Start Position End Position
MCS MCS restriction enzyme-type multiple cloning site 45 129
bacterial origin ColE1 ColE1 (pUC-type) origin of replication 4111 4574
negative selection marker SacB SacB negative selection marker gene (sucrose sensitivity) 1057 2972
primer site M13 primer M13 primer sequencing site 4839 4855
primer site T7 primer T7 RNA Pol primer sequencing site 4865 4883
recombination site loxP site loxP recombination site 1015 1048
recombination site loxP site loxP recombination site 9 42
selectable marker CmR chloramphenicol resistance gene ORF (functional only after recombination of insert into vector with promoter) 986 327
selectable marker AmpR ampicillin resistance gene 3103 3963
splice donor site SD site splice donor site 132 136
tag HN 6xHN epitope tag 141 176

 

  • Gene
  • Pathways
  • Protein
  • Clone
  • Organism
  • Genome
  • Reagents

Gene

 

Gene Symbol : SERPINE1
Symbol Nomenclature : SERPINE1
SYNONYM : PAI; PAI-1; PAI1; PLANH1
Designation : endothelial plasminogen activator inhibitor|plasminogen activator inhibitor 1|serine (or cysteine) proteinase inhibitor, clade E (nexin, plasminogen activator inhibitor type 1), member 1|serpin E1
Full Nomenclature : serpin peptidase inhibitor, clade E (nexin, plasminogen activator inhibitor type 1), member 1
GENEID : 5054
GI : 61358892
GenBank Accession : AY888695
HGNC : 8583
MIM : 173360
Vega : OTTHUMG00000157107
Target GenBank: XM_054850

 

Reference Sequence Alignment

  

HsCD00001680      ATGCAGATGTCTCCAGCCCTCACCTGCCTAGTCCTGGGCCTGGCCCTTGTCTTTGGTGAA
NM_000602.4       ATGCAGATGTCTCCAGCCCTCACCTGCCTAGTCCTGGGCCTGGCCCTTGTCTTTGGTGAA
                  ************************************************************

HsCD00001680      GGGTCTGCTGTGCACCATCCCCCATCCTACGTGGCCCACCTGGCCTCAGACTTCGGGGTG
NM_000602.4       GGGTCTGCTGTGCACCATCCCCCATCCTACGTGGCCCACCTGGCCTCAGACTTCGGGGTG
                  ************************************************************

HsCD00001680      AGGGTGTTTCAGCAGGTGGCGCAGGCCTCCAAGGACCGCAACGTGGTTTTCTCACCCTAT
NM_000602.4       AGGGTGTTTCAGCAGGTGGCGCAGGCCTCCAAGGACCGCAACGTGGTTTTCTCACCCTAT
                  ************************************************************

HsCD00001680      GGGGTGGCCTCGGTGTTGGCCATGCTCCAGCTGACAACAGGAGGAGAAACCCAGCAGCAG
NM_000602.4       GGGGTGGCCTCGGTGTTGGCCATGCTCCAGCTGACAACAGGAGGAGAAACCCAGCAGCAG
                  ************************************************************

HsCD00001680      ATTCAAGCAGCTATGGGATTCAAGATTGATGACAAGGGCATGGCCCCCGCCCTCCGGCAT
NM_000602.4       ATTCAAGCAGCTATGGGATTCAAGATTGATGACAAGGGCATGGCCCCCGCCCTCCGGCAT
                  ************************************************************

HsCD00001680      CTGTACAAGGAGCTCATGGGGCCATGGAACAAGGATGAGATCAGCACCACAGACGCGATC
NM_000602.4       CTGTACAAGGAGCTCATGGGGCCATGGAACAAGGATGAGATCAGCACCACAGACGCGATC
                  ************************************************************

HsCD00001680      TTCGTCCAGCGGGATCTGAAGCTGGTCCAGGGCTTCATGCCCCACTTCTTCAGGCTGTTC
NM_000602.4       TTCGTCCAGCGGGATCTGAAGCTGGTCCAGGGCTTCATGCCCCACTTCTTCAGGCTGTTC
                  ************************************************************

HsCD00001680      CGGAGCACGGTCAAGCAAGTGGACTTTTCAGAGGTGGAGAGAGCCAGATTCATCATCAAT
NM_000602.4       CGGAGCACGGTCAAGCAAGTGGACTTTTCAGAGGTGGAGAGAGCCAGATTCATCATCAAT
                  ************************************************************

HsCD00001680      GACTGGGTGAAGACACACACAAAAGGTATGATCAGCAACTTGCTTGGGAAAGGAGCCGTG
NM_000602.4       GACTGGGTGAAGACACACACAAAAGGTATGATCAGCAACTTGCTTGGGAAAGGAGCCGTG
                  ************************************************************

HsCD00001680      GACCAGCTGACACGGCTGGTGCTGGTGAATGCCCTCTACTTCAACGGCCAGTGGAAGACT
NM_000602.4       GACCAGCTGACACGGCTGGTGCTGGTGAATGCCCTCTACTTCAACGGCCAGTGGAAGACT
                  ************************************************************

HsCD00001680      CCCTTCCCCGACTCCAGCACCCACCGCCGCCTCTTCCACAAATCAGACGGCAGCACTGTC
NM_000602.4       CCCTTCCCCGACTCCAGCACCCACCGCCGCCTCTTCCACAAATCAGACGGCAGCACTGTC
                  ************************************************************

HsCD00001680      TCTGTGCCCATGATGGCTCAGACCAACAAGTTCAACTATACTGAGTTCACCACGCCCGAT
NM_000602.4       TCTGTGCCCATGATGGCTCAGACCAACAAGTTCAACTATACTGAGTTCACCACGCCCGAT
                  ************************************************************

HsCD00001680      GGCCATTACTACGACATCCTGGAACTGCCCTACCACGGGGACACCCTCAGCATGTTCATT
NM_000602.4       GGCCATTACTACGACATCCTGGAACTGCCCTACCACGGGGACACCCTCAGCATGTTCATT
                  ************************************************************

HsCD00001680      GCTGCCCCTTATGAAAAAGAGGTGCCTCTCTCTGCCCTCACCAACATTCTGAGTGCCCAG
NM_000602.4       GCTGCCCCTTATGAAAAAGAGGTGCCTCTCTCTGCCCTCACCAACATTCTGAGTGCCCAG
                  ************************************************************

HsCD00001680      CTCATCAGCCACTGGAAAGGCAACATGACCAGGCTGCCCCGCCTCCTGGTTCTGCCCAAG
NM_000602.4       CTCATCAGCCACTGGAAAGGCAACATGACCAGGCTGCCCCGCCTCCTGGTTCTGCCCAAG
                  ************************************************************

HsCD00001680      TTCTCCCTGGAGACTGAAGTCGACCTCAGGAAGCCCCTAGAGAACCTGGGAATGACCGAC
NM_000602.4       TTCTCCCTGGAGACTGAAGTCGACCTCAGGAAGCCCCTAGAGAACCTGGGAATGACCGAC
                  ************************************************************

HsCD00001680      ATGTTCAGACAGTTTCAGGCTGACTTCACGAGTCTTTCAGACCAAGAGCCTCTCCACGTC
NM_000602.4       ATGTTCAGACAGTTTCAGGCTGACTTCACGAGTCTTTCAGACCAAGAGCCTCTCCACGTC
                  ************************************************************

HsCD00001680      GCGCAGGCGCTGCAGAAAGTGAAGATCGAGGTGAACGAGAGTGGCACGGTGGCCTCCTCA
NM_000602.4       GCGCAGGCGCTGCAGAAAGTGAAGATCGAGGTGAACGAGAGTGGCACGGTGGCCTCCTCA
                  ************************************************************

HsCD00001680      TCCACAGCTGTCATAGTCTCAGCCCGCATGGCCCCCGAGGAGATCATCATGGACAGACCC
NM_000602.4       TCCACAGCTGTCATAGTCTCAGCCCGCATGGCCCCCGAGGAGATCATCATGGACAGACCC
                  ************************************************************

HsCD00001680      TTCCTCTTTGTGGTCCGGCACAACCCCACAGGAACAGTCCTTTTCATGGGCCAAGTGATG
NM_000602.4       TTCCTCTTTGTGGTCCGGCACAACCCCACAGGAACAGTCCTTTTCATGGGCCAAGTGATG
                  ************************************************************

HsCD00001680      GAACCCTGA
NM_000602.4       GAACCCTGA
                  *********

Pathways

NCI : Direct p53 effectors
NCI : E2F transcription factor network
NCI : HIF-1-alpha transcription factor network
NCI : HIF-2-alpha transcription factor network
NCI : Regulation of nuclear SMAD2/3 signaling
NCI : Urokinase-type plasminogen activator (uPA) and uPAR-mediated signaling
NCI : p73 transcription factor network
Panther : Blood coagulation
Panther : Plasminogen activating cascade
Panther : p53 pathway
Reactome : BMAL1:CLOCK,NPAS2 activates circadian gene expression
Reactome : Circadian Clock
Reactome : Disease
Reactome : Dissolution of Fibrin Clot
Reactome : ECM proteoglycans
Reactome : Extracellular matrix organization
Reactome : Gene Expression
Reactome : Generic Transcription Pathway
Reactome : Hemostasis
Reactome : Loss of Function of SMAD2/3 in Cancer
Reactome : Loss of Function of SMAD4 in Cancer
Reactome : Loss of Function of TGFBR1 in Cancer
Reactome : Loss of Function of TGFBR2 in Cancer
Reactome : Platelet activation, signaling and aggregation
Reactome : Platelet degranulation
Reactome : Response to elevated platelet cytosolic Ca2+
Reactome : SMAD2/3 MH2 Domain Mutants in Cancer
Reactome : SMAD2/3 Phosphorylation Motif Mutants in Cancer
Reactome : SMAD2/SMAD3:SMAD4 heterotrimer regulates transcription
Reactome : SMAD4 MH2 Domain Mutants in Cancer
Reactome : Signal Transduction
Reactome : Signaling by TGF-beta Receptor Complex
Reactome : Signaling by TGF-beta Receptor Complex in Cancer
Reactome : TGFBR1 KD Mutants in Cancer
Reactome : TGFBR1 LBD Mutants in Cancer
Reactome : TGFBR2 Kinase Domain Mutants in Cancer
Reactome : TGFBR2 MSI Frameshift Mutants in Cancer
Reactome : Transcriptional activity of SMAD2/SMAD3:SMAD4 heterotrimer
WikiPathway : Adipogenesis
WikiPathway : Blood Clotting Cascade
WikiPathway : Complement and Coagulation Cascades
WikiPathway : Folate Metabolism
WikiPathway : Selenium Pathway
WikiPathway : Senescence and Autophagy
WikiPathway : TGF Beta Signaling Pathway
WikiPathway : Vitamin B12 Metabolism

Protein

SMART domain : SERPIN : SERine Proteinase INhibitors
UniProt : B7Z4S0
UniProt : P05121
HPRD : 01418

Clone

Cloning Information : 31026
HIP Master Clone ID : 61402
Original Clone ID : FLH031026.01X

Organism


TAX_ID : 9606
Species Specific ID: 5054

Genome

Chromosome : 7
Map Location : 7q22.1
Ensembl : ENSG00000106366

Reagents

Labome : PAI-1-antibody