DNASU Plasmid Repository • 480.965.5697 | Email

FADD (Homo sapiens) in pDONR201 (Gateway donor/master vector)

TOP

Explanation of Terms


Gene: Gene Symbol:  FADD
Gene Name:  Fas (TNFRSF6)-associated via death domain
Sequence              Map: pDONR cofig.pdf
Original Clone ID: FLH056887.01X
Keyword: None
Species: Homo sapiens
Type: cDNA
Vector Name: pDONR201               Format:  CLOSED
Source: HIP
Description: None
Comments: None
Mutation/
Discrepancy :
No / Yes
Publications: None
Authors: HIP
HsCD00001693

Price:  Login for Pricing
AVAILABLE
No restriction
Special MTA: None

 

Insert sequence: 627nts         Open reading frame : 1 to 627
Reference Sequence Alignment

ATGGACCCGTTCCTGGTGCTGCTGCACTCGGTGTCGTCCAGCCTGTCGAGCAGCGAGCTG
ACCGAGCTCAAGTTCCTATGCCTCGGGCGCGTGGGCAAGCGCAAGCTGGAGCGCGTGCAG
AGCGGCCTAGACCTCTTCTCCATGCTGCTGGAGCAGAACGACCTGGAGCCCGGGCACACC
GAGCTCCTGCGCGAGCTGCTCGCCTCCCTGCGGCGCCACGACCTGCTGCGGCGCGTCGAC
GACTTCGAGGCGGGGGCGGCGGCCGGGGCCGCGCCTGGGGAAGAAGACCTGTGTGCAGCA
TTTAACGTCATATGTGATAATGTGGGGAAAGATTGGAGAAGGCTGGCTCGTCAGCTCAAA
GTCTCAGACACCAAGATCGACAGCATCGAGGACAGATACCCCCGCAACCTGACAGAGCGT
GTGCGGGAGTCACTGAGAATCTGGAAGAACACAGAGAAGGAGAACGCAACAGTGGCCCAC
CTGGTGGGGGCTCTCAGGTCCTGCCAGATGAACCTGGTGGCTGACCTGGTACAAGAGGTT
CAGCAGGCCCGTGACCTCCAGAACAGGAGTGGGGCCATGTCCCCGATGTCATGGAACTCA
GACGCATCTACCTCCGAAGCGTCCTGA


Coding Sequence Details
Insert Sequence Verified?: Y Verification Method: Sequence Verification
Reference Sequence Annotations:
End on reference sequence 771
Start on reference sequence 145
Mutations:
None
Discrepancy:
t95g,V32G
                                

5' Linker Sequence:
GTACAAAAAAGCAGGCTCCACC(atg-goi)

3' Linker Sequence:
(goi-stop)GACCCAGCTTTCTTGTAC

 

 Recommended Growth Condition:

Distributed in bacterial strain : DH5-alpha T1 phage resistant
Antibiotic Selection: Host Type:  bacterial    Marker:  kanamycin
Bacterial Selection Condition:  50ug/mL kanamycin
Growth Condition:  Growth with the single antibiotic in LB at 37 degrees is recommended.
Comments:  Conditions for Gateway-type vectors in recombined (with insert) form and other kanamycin resistant vectors.
Protein Expression Results: None
Recommended expression in: Not Applicable
       DyNA Vector Map

         Powered by LabGenius

Vector Name: pDONR201

pDONR201 in advanced viewed

Synonyms: None
Sequencing Primer: Forward:  pDONR201-forward
Reverse:  pDONR201-reverse
Description: Recombinational donor/master vector; kanamycin resistance; recombinational cloning.
Comments: The position of features were determined for the unrecombined (empty) form of the vector, which is described in detail on the Invitrogen website.
Size (bp): 4470
Parent Vector: None
Empty Vector: None
Properties: Gateway, donor (entry), recombinational cloning
Author Name: Invitrogen
Publications: None
Vector Map:         Vector Sequence:
Sequence:

 



Vector Features:

Type Name Description Start Position End Position
bacterial origin ColE ColE1 (pUC-type) origin of replication (modified, low copy number) 3744 4426
negative selection marker ccdB ccdB negative selection gene (death cassette), LOST in recombined (with insert) form 1264 959
primer site forward primer recommended forward primer site 5 tcgcgttaacgctagcatggatctc 3 300 324
primer site reverse primer recommended reverse primer site 5 gtaacatcagagattttgagacac 3 2769 2792
recombination site attL2 attL recombination site 2 present in recombined (with insert) form only, position is approximate 2744 2513
recombination site attP1 attP recombination site 1 LOST in recombined (with insert) form 332 563
recombination site attP2 attP recombination site 2 LOST in recombined (with insert) form 2744 2513
recombination site attL1 attL recombination site 1 present in recombined (with insert) form only, position is approximate 332 563
selectable marker CmR chloramphenicol resistance gene, LOST in recombined (with insert) form 2265 2513
selectable marker KanR kanamycin resistance gene 2868 3677
trxn termination sequence rrn T2 rrn T2 transcription termination sequence 73 100
trxn termination sequence rrn T1 rrn T1 transcription termination sequence 232 275

 

  • Gene
  • Pathways
  • Protein
  • Clone
  • Organism
  • Genome
  • Reagents

Gene

 

Gene Symbol : FADD
Symbol Nomenclature : FADD
SYNONYM : MORT1
Designation : Fas-associating death domain-containing protein|Fas-associating protein with death domain|growth-inhibiting gene 3 protein|mediator of receptor induced toxicity|mediator of receptor-induced toxicity|protein FADD
Full Nomenclature : Fas (TNFRSF6)-associated via death domain
GENEID : 8772
Locus Tag : GIG3
GI : 60817873
GenBank Accession : AY893405
HGNC : 3573
MIM : 602457
Vega : OTTHUMG00000167264
Target GenBank: X84709

 

Reference Sequence Alignment

  

HsCD00001693      ATGGACCCGTTCCTGGTGCTGCTGCACTCGGTGTCGTCCAGCCTGTCGAGCAGCGAGCTG
NM_003824.3       ATGGACCCGTTCCTGGTGCTGCTGCACTCGGTGTCGTCCAGCCTGTCGAGCAGCGAGCTG
                  ************************************************************

HsCD00001693      ACCGAGCTCAAGTTCCTATGCCTCGGGCGCGTGGGCAAGCGCAAGCTGGAGCGCGTGCAG
NM_003824.3       ACCGAGCTCAAGTTCCTATGCCTCGGGCGCGTGGGCAAGCGCAAGCTGGAGCGCGTGCAG
                  ************************************************************

HsCD00001693      AGCGGCCTAGACCTCTTCTCCATGCTGCTGGAGCAGAACGACCTGGAGCCCGGGCACACC
NM_003824.3       AGCGGCCTAGACCTCTTCTCCATGCTGCTGGAGCAGAACGACCTGGAGCCCGGGCACACC
                  ************************************************************

HsCD00001693      GAGCTCCTGCGCGAGCTGCTCGCCTCCCTGCGGCGCCACGACCTGCTGCGGCGCGTCGAC
NM_003824.3       GAGCTCCTGCGCGAGCTGCTCGCCTCCCTGCGGCGCCACGACCTGCTGCGGCGCGTCGAC
                  ************************************************************

HsCD00001693      GACTTCGAGGCGGGGGCGGCGGCCGGGGCCGCGCCTGGGGAAGAAGACCTGTGTGCAGCA
NM_003824.3       GACTTCGAGGCGGGGGCGGCGGCCGGGGCCGCGCCTGGGGAAGAAGACCTGTGTGCAGCA
                  ************************************************************

HsCD00001693      TTTAACGTCATATGTGATAATGTGGGGAAAGATTGGAGAAGGCTGGCTCGTCAGCTCAAA
NM_003824.3       TTTAACGTCATATGTGATAATGTGGGGAAAGATTGGAGAAGGCTGGCTCGTCAGCTCAAA
                  ************************************************************

HsCD00001693      GTCTCAGACACCAAGATCGACAGCATCGAGGACAGATACCCCCGCAACCTGACAGAGCGT
NM_003824.3       GTCTCAGACACCAAGATCGACAGCATCGAGGACAGATACCCCCGCAACCTGACAGAGCGT
                  ************************************************************

HsCD00001693      GTGCGGGAGTCACTGAGAATCTGGAAGAACACAGAGAAGGAGAACGCAACAGTGGCCCAC
NM_003824.3       GTGCGGGAGTCACTGAGAATCTGGAAGAACACAGAGAAGGAGAACGCAACAGTGGCCCAC
                  ************************************************************

HsCD00001693      CTGGTGGGGGCTCTCAGGTCCTGCCAGATGAACCTGGTGGCTGACCTGGTACAAGAGGTT
NM_003824.3       CTGGTGGGGGCTCTCAGGTCCTGCCAGATGAACCTGGTGGCTGACCTGGTACAAGAGGTT
                  ************************************************************

HsCD00001693      CAGCAGGCCCGTGACCTCCAGAACAGGAGTGGGGCCATGTCCCCGATGTCATGGAACTCA
NM_003824.3       CAGCAGGCCCGTGACCTCCAGAACAGGAGTGGGGCCATGTCCCCGATGTCATGGAACTCA
                  ************************************************************

HsCD00001693      GACGCATCTACCTCCGAAGCGTCCTGA
NM_003824.3       GACGCATCTACCTCCGAAGCGTCCTGA
                  ***************************

Pathways

NCI : Caspase Cascade in Apoptosis
NCI : Ceramide signaling pathway
NCI : FAS (CD95) signaling pathway
NCI : HIV-1 Nef: Negative effector of Fas and TNF-alpha
NCI : TNF receptor signaling pathway
NCI : TRAIL signaling pathway
Panther : Apoptosis signaling pathway
Panther : FAS signaling pathway
Reactome : Activated TLR4 signalling
Reactome : Apoptosis
Reactome : Caspase-8 activation
Reactome : Death Receptor Signalling
Reactome : Dimerization of procaspase-8
Reactome : Extrinsic Pathway for Apoptosis
Reactome : FasL/ CD95L signaling
Reactome : Immune System
Reactome : Innate Immune System
Reactome : MyD88-independent cascade
Reactome : NF-kB activation through FADD/RIP-1 pathway mediated by caspase-8 and -10
Reactome : RIG-I/MDA5 mediated induction of IFN-alpha/beta pathways
Reactome : Regulation by c-FLIP
Reactome : TNF signaling
Reactome : TRAIL signaling
Reactome : TRIF-mediated TLR3/TLR4 signaling
Reactome : TRIF-mediated programmed cell death
Reactome : Toll Like Receptor 3 (TLR3) Cascade
Reactome : Toll Like Receptor 4 (TLR4) Cascade
Reactome : Toll-Like Receptors Cascades
WikiPathway : Alzheimers Disease
WikiPathway : Apoptosis
WikiPathway : Apoptosis Modulation and Signaling
WikiPathway : Apoptosis Modulation by HSP70
WikiPathway : FAS pathway and Stress induction of HSP regulation
WikiPathway : Integrated Breast Cancer Pathway
WikiPathway : Regulation of toll-like receptor signaling pathway
WikiPathway : TNF alpha Signaling Pathway
WikiPathway : TWEAK Signaling Pathway
WikiPathway : Toll-like receptor signaling pathway

Clone

Cloning Information : 56887
HIP Master Clone ID : 35175
Original Clone ID : FLH056887.01X

Organism


TAX_ID : 9606
Species Specific ID: 8772

Genome

Chromosome : 11
Map Location : 11q13.3
Ensembl : ENSG00000168040

Reagents

Labome : FADD-antibody